GenePrediction:GLEAN_287 Details

Name: GLEAN_287
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:780482..781617 (+ strand)
Length: 1136
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:780482..781436 (+ strand)
Length: 955
Type: CDS
Source: GLEAN
Position: GCSC_167:781526..781617 (+ strand)
Length: 92
>GLEAN_287 class=GenePrediction position=GCSC_167:780482..781617 (+ strand)
ATGTCGAGCCTGCGCTCGGTTCTGCTCTCCCAGAGAGCCGTTTGCTCTCTGCCGCTTCAGCTTGAACGACAATTTTCTCT
CTTGCGGGTGGGCTCCGGCGTTCCGAGCACAACAGCCACTGCCAACAGCAGCAGAACACCTTCCGAGACCAGGAGGAGCT
CCACATTCGGCGGTGCGGACAACGGGAGTCTGACGGGGTCCAACGAGATTTCTTCGGTCGGAGATGTTCTGGCCATAACC
GGCTTTGAGAGGGGCGGGGGAGCGTTGGATGGCGTTACCACATCGTTGGATGGTACAGCAACTTCAACGCTGACCGGATA
CGCCCGGCCGGTACCGGCTTCGCCGTCATACTTCTCGCGGCAGCCGAATTTCAACGACAGTTTTTTGCGGCTGCAGACGT
TGTTTCGAAAGTACGGACACCTTCCTCTGGTCCCGGCAGAACAGGTCGAACGAGTTGCTTGGAGGAGCCTGCGAGACTAC
CGGCACAACAGCGGCGAGGAGATCAAGGCGCCACAATACAACAAGTGCATCGCCATCGTCAAGCATCTGAACAAGATCCA
CCCGACCCTGAAGCCGGCCGGCTTGGCAGACGCGCTGAACGAGTTTAAGCGTGAGGTCAACCCGTTTGACAACGTGGCCA
AGCAGCTCACGATAGACCGCTTTGGCCGGGCTGTCGGCGTGGGCCGCCGTAAGACATCGGTGGCGCGGGCGTGGGTGGTG
GAGGGCACGGGCGAGATGCAGGTCAACGGCAAGAGCCTAAGCGAGATGTTTGGGCGTGTGCACGACCGCGAGAGCGCCAC
CTGGGCTCTGCGGGCGACAAACCGGATGGACAAGTACAACGTCTGGGCGCTGGCAGAAGGCGGCGGCACCACTGGACAGG
CCGAGGCACTCACCTTGGCAGTGGCCAAGGCTCTCGTAGCTCACGAGCCAGCGCTCAAGACGGCGCTCCGGAAAGGTACG
TTGCAATCCTTGTGCTTTCAATACCAGCCGTTCTCTTTCGCCACAAGCTGCCCTAGCTAACAATATGTTTTTCGCGCAAT
CTAGCCGGCTGTATCGCTCGCGACCCGAGAATGGTGGAGCGGAAGAAGCACGGTCATGTGAAGGCAAGAAAGATGCCTGC
CTGGGTCAAGAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62