GenePrediction:GLEAN_2880 Details

Name: GLEAN_2880
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3960068..3961383 (+ strand)
Length: 1316
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3960068..3960258 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_140:3960312..3960536 (+ strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_140:3960606..3961383 (+ strand)
Length: 778
>GLEAN_2880 class=GenePrediction position=GCSC_140:3960068..3961383 (+ strand)
ATGGTGTCCCACCGCAACCAAACACAGTTTGAGCGCGCGCGATGGCGCAAAGCATTACTGTTCCCGCCGTGGATTCTCCA
GATAGCCATGCTACTGAGTCTCATGGGCATCTTCTCGTACCGCCTCGCCGAGACGGTCGAGAACTATGAGGAGAACAACA
AGAATGGCAAAATGCCCGTGGTCGAGCTTGTGTCAGTGTGCAGGCCAGTCGCTGTCGCGTGTCGACGCATCGCTGACTTT
GCAGGTGGGAATGTACAAACGTCGGCCTGTCTCTCGTCTCTCTGCTCCTCACCATCCTGGAGGTATCCAGGATCTTTTCC
GAAAATCTCACGCCGTTCTTCCTGCTCGCCTCTCACATTGTCAAGTTGACCTGTGCGTTTGCCATTCTCGGCCTCGACAT
TGTCGTGTACACCCAGCGAACGGAAGGAGAGTGGTCAATCATCGGCCTCGCCATTGACGTAGGCTTGCTGTAAGTTCGAG
GCAACCGCTTGGCACGGAGACCGCGGTACTCCAGACATGCATGCTGACAGCCGTGCAGCTTGTCGCTGTTCATTCTCGGC
CCCTACGCGATTCTTAAGTTCCACCGCATGCGTGACGACGATGACATGCCCTATTCTGCCAACGTCAAGCCGTTCGGATT
CAACAGCGAATACACGGAGATTGAGACTGGGACTGTCTCTGGCGGTGACCCCTTTCTGCGTGCGAATCCGTACAACGACG
TGACGACAGAGTATTTGTCGCGGGGCAGCATCGGCGGCGTAACAGGCCGCGACCGGTCGGTGTCAGCAACGTCGACACTG
CCCGGCGATGGCGGACGACGGGGCAGCTACAACCACGAGCGGGACACGCAGTTCGACGTGTACCGATCGCGGGCACCAAT
GACACTCAGCCACGAGGACGTGAGCCATGCCATCAGCACAGAGCTGTGGGGCAACGCCGGCGGGCTTACTGCTATCGACC
GGTCCGGCAGCATGGTTGGCTCGGGTATGGTGGCCAGCCGGCCGGTGCAGCCGCGAGTGGACGCTACGAACCGCGCGGCG
AGCTGGACTGTCGAGACAGGGCGTGCGAGCGCCCCCGATAGTTTGTCTGTGCCGACGATACACGAAGAGCACGTCCCGGA
CGAGGAGGAAGAGCCGACCGCCAGGGCGGCCGGACATGTCCACCCTCTGGCACCTGGCCGGGCCGAGAAACAGGCTCTGC
TGCCAGGACACAGCCGCGATGGTAGCCATGATGACGATGACGACGACAACCGGAGGGCCTTCCGGCGGATTCCAGGGACC
GAATCAGAGAACAGCCTTTACGGAGCAAGGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62