GenePrediction:GLEAN_2881 Details

Name: GLEAN_2881
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3962138..3963895 (+ strand)
Length: 1758
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3962138..3962697 (+ strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_140:3962763..3962840 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_140:3962908..3963895 (+ strand)
Length: 988
>GLEAN_2881 class=GenePrediction position=GCSC_140:3962138..3963895 (+ strand)
ATGCCCGCCGCCATGGAGTCTCAGGCTCGACACCGTCGAGAAGCGCTCCCCCGGACGGCGTCTTCCGAAGGCAAGCAGCC
ACCGGCGCTGACGACGCTGCCGTCGGACTGCTCGACGTCGTTTTATGCCTCCCAGATTGGTGGCCTGTCCGTGATCAACT
ACAGCTACACAGACCTGCCCGGCAAGCTGATGGTGCAAGACGTCTACCAGTTCTTCCGCCTCGCCTGGGCGCTGCCCTAC
ATCGTGTGGCCAACGACGCCGACCGACTCTGGTTCCATGACCGAGCTCGCCCCGACGTCGGGCAACCTCTGGTGTATCGC
CGTCCACGGCGTCCTGATCGTGCTGCAGCTGGGCTTTATTCTGGGTGTGCTGCCGGCCGTGTTCCTGATGTCGGTCTGGG
CAGCTACCGCCATTGTCGGCCTCTGTCTGAGCTTGAACCATGTGCTGTGCATGCTGCTGAACGGCAGGGGCATCGAGTAC
CATTCAAGCCCGGAGTGCGCGCCTGTCCTTCGGGAACACGCGCAGGAGCAGTGGATCTTCATCAACGGTGTTGCCGTGGG
GTAAGTGCGGCACTGACGCCCACTTTTGGCTTGGAATGCTCGCGTGCTGACGGCTGGCTGTGCAGAAAGCACTGGATGCA
GAGCAATCTCGACAGGCTCGCCCTGACCTTCAAGCGGCCCATCCTGGGAGTGCACAACAAGACGTAAGAGAGAATTGTTT
TCTTCTTTATTGTTTCCTCCCGGACGAACTCGTTCTGACCCACATGACAGAAGCGGGATCATTTTCGACGTGATCGAGTG
TCTGATCCAGCGAAACTGTGCTTATGCCACCAAGGACGTCCGCCGTGCCTACGCCATCATCAAGGAGAAGCTGTACCGGC
CCGACATTTCAAAGGTGGTGCTCATCCTACACTCACAGGGCGGCATCGAGGGCGGGCTGGTGCTGGATTGGCTGCTGCAG
GAGGTGCCGCAGGATCTGCTGGTCAAGCTGGAGGTGTACACGTTTGGAAACGCGGCCAACCATTTCAACAACCCCCACCA
CACGATGGATGCACAGGAGCGGGAGCAGCGCATAGTGGAGCCGGCCAGCTCCATCGCGGGCCAACAGGTTTTGGGCCAAG
AGCTGCTCGACAAGCAGCGAGCCGGAGTTCGTAAGGCGAAACTGGTGGTGGAAACGACGTCGAGCCAGCCAGCGGTACTC
ACCGAGCGGGCTATCGGCCATATTGAGCACTACGCGCATACAAGCGACTTTGTGGCGCTCTGGGGCGTGTTGCATTTTGT
CAGCATGGTGCCCGAGTCCAACACCTTGCCGCGCTTTATCGGGCGTGTCTTTGCACGGACATCCCCGCGAGGCGGTCACC
AGCTCGTCCAGCACTACCTCGACGGCATGTTCCCACTGGAAAAGGATGCCGAGACGGGTGTGTTTCTGGGATGTGCCGAA
TCGAACGAGTTTGTCGAGAGCGACGTCGAGATCGGGAAGGAGGGCGACGAGAGCGCTGACGTGCACGAGGCGTTTGAGCA
GAGCTGGGCGGGCACGCTGGCGGAGGACATCCACTGCGAGATGGGCAGCGGTGACTGCAGGCGCAGCACGCAGATTGTGG
CAGATGTGAAGATCCATGCTTCAAGCCCGATTCTGGCTCGCCAGGCCTCACATCCGCGTACGCTCAAGGTGAAGGACGTC
AGCCGGCTGTGGCAGTATCGCAACGGAAAGAGCCCGGACGACAGGCCGAGGGGCCTGGTCCGGCTGGCGACGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62