GenePrediction:GLEAN_2882 Details

Name: GLEAN_2882
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3967217..3968160 (+ strand)
Length: 944
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3967217..3967480 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_140:3967561..3967799 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:3967866..3968160 (+ strand)
Length: 295
>GLEAN_2882 class=GenePrediction position=GCSC_140:3967217..3968160 (+ strand)
ATGCCTCAGCCACCACCACCGGCATACGATCCGCTGCCGTTGGACCGGGCGCTCTACGAGACCATCGCGACGAGCGAGCG
CGTGCAGGCCACGGCGCTGACGGTGCCGGTGCGCAGTGGACGGGCGTGGATCGTGCGAGCTGGTCAGGTATGCCGCATCA
CGACGCCGATGGGACCACAGGTGGGCGACCTAAATGTCTGGAACGCACACAACCCGCGCGAGCGGTTCTGGGCTGCTCGC
ACGCGCCAGCTGCAGCAGAGTCACGTGCGGGTGCACGACCGCCTCTGGAGCTGCCTGCCGTATCTGCGGCCGCTCGTCCA
ACTGTCACGGCCGACTCGCTACAGGGCTACGGTGGCCCCGGTGCCGATGGCGTCGATGCCGTCGGTGGCCGCGTCCACGA
CCTTCTCGGCACGCGCTGCGACCCCTACGTCGACCAGCTCATCAGCGGGTCCGCGTCCGACGTGCACTGCCACTCCAATC
TCGTCCGTGCTGTTCTCCCGTTCGGTCTACACGAGTCCGACGTCCACGACGTCCTTAATGTCTTCCAGGTCACCGGGCTC
GACAGCAAGGGACGCTACTACATGTGAGCTGTCTTATTATTGCTGTCTCTCTTCTCTCACCTCCTCCTTCTCCCTCACTA
ACCCCCCAGGGAACCCTGTCCGGCAAAAGCGGGCGACTACTGGGAATTCTTTGCCGAGATCGACGTCCTTTGCGCCATCT
CTGCCTGTCCCGGCGGTGACCTTTCCAATTGGGGCTGGGGCGAGGCCGGCGCCGACAACGGCCTCGACATGGCCGACTGC
TGCCGCCCACTCGTCGTCGAGGTCTACGACATTGTCGACCGCGATACCGTCCTCAAGAATTGGAAGAGCCCCGAGCCCGC
CATTGCCGCCTACAAGGGCGTCCACGGGCTGGTCGGGCCGGACACTGTGACAAAAACACAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62