GenePrediction:GLEAN_2885 Details

Name: GLEAN_2885
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3988346..3988680 (+ strand)
Length: 335
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3988346..3988485 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_140:3988539..3988680 (+ strand)
Length: 142
>GLEAN_2885 class=GenePrediction position=GCSC_140:3988346..3988680 (+ strand)
ATGTCTAGCGACTCGTCTTCATGGGGTGCACAGACACTGATGGATCTTGCATTTGGCATCATCACATCGGTTACTGGCAT
CACGAGCGTGCTGGTCGCCGTGTCGGCCATGCGCAAGACGCAGGCGCCATCGGCACGAAAGTAAGACTTCAACTTCCCAG
ATATGAGTGAACCGTGCTTAAACGATCACACAGCCATGACAGCCCAACCCCCATTGCGTTTTTTGAAGAAACGAGAGCCG
AAGAGACGGAGTCTGCTCTACCAGCGGGGAACGCTTCAAACATGACAATGGGTTCTGGTTCGGACGTGTTCGAGTTGATC
GAGTTGCCTGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62