GenePrediction:GLEAN_2887 Details

Name: GLEAN_2887
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3993064..3996701 (+ strand)
Length: 3638
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3993064..3993217 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_140:3993266..3993423 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_140:3993533..3993771 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:3994544..3996701 (+ strand)
Length: 2158
>GLEAN_2887 class=GenePrediction position=GCSC_140:3993064..3996701 (+ strand)
ATGATATCACCTGTTCTCCTCGCCTGTCTCTCCCTTGTCCTCAGCGTTCTCTCCTCTCCGTTAAATCTTGGCGCCAACAA
TACTATGATTTTGTCTTCCATCTCTGACGGCACAGTCTTCCTGCCGCCAGCCGACAGCACCGGCATTAAAAACGGTAGGT
CGTTTATTCTCCCACTCGCCAGCTCTCGCTCAACTCTACCAGGAATGCTCTGTGGCAACTTCGCCACGGCCAGCAAGAAC
GACGTGGTCTTTATGTTGCGCGAGTTCCGGCGCCAGTATCCCGACGGCTCCGACGACTTATGCGGTGCGCCAGCCAATAC
GTGCACTCGTCAGACCTGCCGCAACACGAGCGGACTCTACGTAAGTTTTTATTCGAGCGTATCGCGTATGGCATCTAGCT
AACTCTATAGTTCTGTAATGTATGCAAACTTCCAAAGCTTTCTCCGCCTCTCTTCTCACTAATCTGTAGGACAACGCCAC
CGAAACCAACATTCGCTGCTCGACCATGGCTAACTGGCTGGCCGATATCTGCGACGGCTGCTGCACGACGAGCGTGATGC
AGTCCAAGGGCCTCTCGGGGCAGCAGTTTAGCACGGCCGGCTGGAACGTGGTAGTGGCATTTGCGGACTGTAACGACGAT
CCTGATGCCGACCGACCATCTGACTTTTCGGTCTGGGGGCCCAACGGGCAGTGTCTGAACTACGGAGGGTGAGGGTAGTG
GTGATGATGGGGGTAGAGAGCAGAGTGTAGAGGATGGGGATGAAGGAGAGAAATCAAAGAGTGATCGGGGTGGTCGTTGC
TACGGAAAAGAAGACTAGTGTGATGGAGTAAAAAGGTTCTCGGACGCGAGGAGGAGGAGTGTGTGGGAGTATGGCGGCGT
TTCCGTTTCCCGGGGAATTCTCGCTCACATAGCCATCAGCTGGTTGTCTCTCATAACAAACCTGTTGCCTTAGAGAAACC
TATGGAAAGAAGACCAATACGAAATAGGCATCCACAGCAAAGCTAGGTTTCGCGTCCATCGTCTAAAATTGATACACAAT
CCTGCTAGCAGATGTTGTGAAGGGCCTTCTTCGGCCGTATAATCAAGCCCTTGACTCGTTGCTGTCCTCCCACACGTGAC
TATCTCCCGTGCAAAACCACCGACCTCCCCCCTTTTGTTGACACCCAGCTGACCGCGTTGTCCTGTTGTTGTATCGGACA
GAAAAGAATCTGAGAGAAGCTTCAGATTTTGCACAACTCTTCCTTCCTTTTATCTTTTGCATCATAACCTTCCAGAGCAC
TGGACGGGACCCCCTCCTTCTATAGCCTGCACTTCTATATACAAAGCACAAGGCTCGCACACATCGTCGTCGTCGACAGC
TTGTTGTCGTCTGCGTTTGAAGCACGTCAGCGTTTTTACGATCAGTGAGCAGTTCTTTTGTTCAGTTCAATCCACCCTTT
CACCTTCCTGCATCACTAACCTGCGTTCTCTTTGTTACAGACACGCAACGCTTGGGATAAGAAGAAACATGGATCCCAAG
CACAGCCGCCTCCGGGACTTTCCCGTCGCCTTTGTCGCCGAGACAAACGAGCAAGAGGCCAAGGACGGTGATCCGTTCTA
CAGCACTGACGGGGAGTCTGACTTCAGCACGGGTGTGAACCGTGGCTCGGACAACAGTGCCATGGTCAAGAAGTCTGTGT
CGCAGCCTGCGGTTAGGGGAGCTGCCCTGACCATCCCGCCCACGTCTGAGGATGCCATGGCGGCTGCCATTGCAGCCATG
GAGTCTGGGGCCGATATGTTTCCCGAGATGGCCTCGTTCCTCGCCCGCAAGAGCATCGACCGCAACGAGGCTGCGGCCAA
GAAAGCGGCCGAGCTTGCTAAGATAGCCGTTGCCAAGCAGGCCGCCGAAGAGTCTACCCGGGCTGCTGCCAAGAAGGCGG
CCCAAGCTTCGCTCGTGGCCAAGCCCTCCATCAATGTCTGGGGCGGAGGGAGTGACGGCATCGAGGCTTCGCCGACGGTC
GTGGATGACGACGCTGACTGGGTCGTCTCGGACGAACGGGCTCGTGATGCAGGCAATGGACGCATGATTCATGAGGCCAC
GCTCATCCAGCGCGGCCATATCTCGCGCGAGACTGTGCGCACCATGCCGGCTGCCCTGTCGGTCGATGAGAATGCCTATG
ATGGTGAGAGTGGTGGAGTTCCTCTCTACGCTGGCAACAATGGCAATTCTCGCATTGCTGGAAACACTGGAAACGGTGGT
CATGGGGGCACTGGTGCCAACAACGACGGCCCTGCCCATGATTGCTATGAGCAGTACCCTCAGTACTCGCTCCCGGCACG
CTCTGGCATTCCGGAGCCAAAGCAGCGCCGTCAGCAGCGTCTGAAGCTTCAAGAGCTTCCTGTCACGCCGCCTCCTCGCA
ATAAGGGGGCTCCTCGCATTGCCCCGCAGAAGGAGCTTCCGGAACGTCCCAAGGTTCAAAAGGTCGTGCATCCCGAGACC
AAGCCGGAGCAGAAGGTGTACCACAATCAGGTGCGCCCTCCGGTTCAGCACGTTCAGCTGAAGAAGGTGCCTGTGAGGCA
GGTGCAGGTGCATCACGTTCAGTCCGGGCCCAAGTCGGAGATTGTTCACCACAAGCATCACAAGGTGCAGACCCATGTTG
AGCCCCAGACTTTTCCTCAGATCCGTCCCCGGGTTCAGACTCCGAAGAAGTTTGCTCCCTCTGCAGAGGGTTTCCATGAC
CAGATGGATCTTGACCACACGCCTGTTGACAACAAGGCACGTGACCACAAGGCCATGGAACACAAAGCCATTGATGGTAA
AGCTGCTGATCACATGGTCATTGATGACAAAGCCAACGACGTCACGGACCATGCTCATCAGGCTGTTGAGTCCAAGGTCA
GCGAGCAAGCTGCCGACGAGAAGAAGGCTGTGCCGGCGACGACGCCGGTGATTGACTTTGCGGACGCGCGGGCTGCCCAC
ATTGCGCGCTGGGTTCTCGGTGAGCGTCACCGCCACCTGGACATGACGGACGACGGTGGTTCTGATGGGATCGCTGTCGG
AGGCAGTGGTGGCAAGACTGGCGTTGATCATGGCGTCGCCGACGGGGCGACTGAGGTCACGGCCGACCGTCTGCAGTGGC
CGACGCTTCTCCGTGATCCGACGGTGAACAACGACAAGCTCCCGGCGACGGAGCCGACCGGCGCGCAGCACCAGCTCAGA
ATGACCATCCTGACCAACTTTGCTGAGCGCTGCCGCCAAGAACATGGCAACGGGGGCGATGAGCACCGGGACGACAACGG
CTATGCTGTCCCTCTTTGCTCGCTCTGCCTTCCGGCCGACGCTTTCACCATGCGGCCGCAGCACGGCCACCTCTTCCTCG
ACAGCGTTCTGCTGCCGCTGGCTGAGGCTATCAGCTATGCCGAGATGGTCGTGCAGGTCAACACGGCATTGATTGAGCGC
GTGTTCAAAGAGGCCGGCCTGGGCGAGTCGCATGACACGGAGCCGATGGCCGGTCCCTGGAACAGCATCCGCGCGATGCC
TATCTACGAGGACTACCAGCGGGCCCTCGTGCTGGCCACGCACCGTCGTCGCCTGTTCGACGAGCTTCCGATGACCGTCG
ACACCTGCGGTCTGCTCATGAAGGGGTATCGCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62