GenePrediction:GLEAN_2888 Details

Name: GLEAN_2888
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3999820..4001811 (+ strand)
Length: 1992
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3999820..4000053 (+ strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_140:4000111..4001811 (+ strand)
Length: 1701
>GLEAN_2888 class=GenePrediction position=GCSC_140:3999820..4001811 (+ strand)
ATGGATCTGCTTGAGCCATCTCCGCGCGCACCACTGCCGTCGTCGCAGCGCAGTCCTGGGGGCGAAGGCGGAGCGGACGA
TGTGAAGCAGGGGCGATGCAGCATGGACGAGACGGAGAGCGTGAAGGCGATGACAATGACGACAACGACGGCCATGTCTT
CTCCTGGTCGCAGGCATGACCGAACGACACGAATCAGCAAAGCCTGTGACATGTGTCGGGCACGGAAAGTGAAGGTAAGC
CCGTGTTCTGTCGGCTATTCGTTCTACTCTGTCATTCCTAACAGAAAAAAGTGCGATGCCGCTCAGCCATGTCGATCCTG
TCGTGAGCTCGGCGTTGCCTGCACGACACAGTACGTCTCGCGTCGACGAGGTCCGGCGAGCAAGTACGCTGTCCATTCGG
GAGCGACTGTGTGTGTGCCATCGCCTGGATCCGACGTTGTGGCAGCATCGGCCATCCCAGCTGCCATCACGGCCACGACA
CCCTCAACGGACGACATCGCGCCACTGCCCGTGCTCGCCCTTCTGGTAGACGACTTCTTCACGTACATCCACCCGCTGAT
TCCGTTTCCGCACGAGCCGACGTTCCGGCAGCGGTTTGCCAGCGAGACCACGCGACGCGAACCCGTCTTTCTGGCGCTGC
TGGCGGCCATGGTCGGCAGTCTGGCCGCATCGTTTCCGCGCAGCGTGCGGGCGCAGCGCGAGACCGGCCCCGGCAGTCTG
CGCTTTCCGCGAGCCTCCAGCATGGTGGCGTGCTGTCGCGGCGTGGCGCTGGCATCGCGCGGCGCCCAGTTCTACAACAC
GACGCGGTCCATGACGACAGACGATGCGGCCACGAGCTATCTGTTGGGCCTCGCAGCCGGCTACACGTCGGACTGGCAGC
TCTGCCGGCGGTTCATGGCCGAGGCCATGTCGTTTGTGCAGGAGGTCGGCGTGCTGGCCAGCGAGACGGACACGAACAAC
AGCCTGCATCCGATCGACGAGCAGATCGGCCGCCGCATCTACTGGATCCTCTTCCTGGCCGCTCGCTCGATGCAGCAGAC
CGGCGCATCACCCGCTGATGTCCCCATTCCGCTCGTCTTTCTGCATCCCAGCCACCGACGGCCACGGCTGCCGGCCGAGG
TCGACGACGCCTTCATCACGGCAGCTGGCGTCGGCATCCAACCGCCTGGCGTCGTCTCGCTTCTGACTGGCTTCAACCGT
GTCGTGCAGGTGTACGCAACCATGGATCGGGTCGGCGAGGGTTTGATTGGTACAGCACCCGACCAGGCTGCCGCTCTTAT
GGACGCTCTTCAGGCAGCCAAGGCTCTCGGCGATGCTCTTCCGGATGAGCTGCATCTCCCGCTTCCAGGAAGTAGTAGAC
ATCCTCCCTCTACCCCCCCTTGTGACGACTTCTACGACAACGTAACCGGCTACCGCTACTATCCTCCGGCACCTCTCGCT
ACGGCCGACGATGTCCGCTTGCTGCTCGGCCAACAGCCGCGACGTCGCCGTCAGGTCCAGTACGACATCCAGAAGACCAA
CATCTATGCCTCGCTGCTGGCGACACGGTCGTATTATGTCGAGCGCTACGGACAGCTGCTCGGCCGCCTCGGTGACGACG
ACGCTGCCGCTGCTGCCATCGCGGCTGAGCGCGACCTCATCGTTCGCTCGCTCCTCCTCGTCCTCGCTGCTATCCCGCAG
TGCAACATGGAGCCCAACGGGTGCGCGCTCATCAACAAGATCCGACAGGTCGCGTCTACGCTGCTCGGCAACATCGCCGA
CGAAGCTGCTGCCCAGCTTGGCCGCTTCCTCGAGATTCTCGTCAAGCTCGAACGGATCGGCCATGGCGGCACGGCTGCAC
AGACGTGTGGAGTGGATCACGTGACCACAGAGGACATCACAACCACGGCCAACGTGGGCCTGGCTGATGAGGAGGAGGAG
CGGCAGAGCTGGGCGAACCTGCGGGAGGAACAGATGCGCTTTGCGGCGAGCGGGGGGTCGATGCTAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62