GenePrediction:GLEAN_288 Details

Name: GLEAN_288
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:791985..794591 (+ strand)
Length: 2607
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:791985..792058 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_167:792139..792271 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_167:792345..792440 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_167:792499..792630 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_167:792707..793535 (+ strand)
Length: 829
Type: CDS
Source: GLEAN
Position: GCSC_167:793609..794591 (+ strand)
Length: 983
>GLEAN_288 class=GenePrediction position=GCSC_167:791985..794591 (+ strand)
ATGATGTCCTGGTGGTCTTCAGGAGCCAACACGGCTCTGGATGAACAAATAGAGAGAGCTACGAGCAGCAGCCTGTGAGC
CAAACGCTCCTCGAACCCCATGCTTCTCGTCGTCCTCGGCATCCTCTTCAGCTCCTAACAGTTCCTTTTTTCAGGGAGGA
TATTGCTCTGAACCTGGAGATCTCCGACACTATCCGGTCGAAGACGGTCCAGCCGAAGGAGGCCATGCGCTCTTTGAAGA
AGCGAATCGGAAACAAGAATCCGAATACTCAGTTGAGCGCTCTGAACGTACGTCCCCGACGTAGAAGCCGCAATGCTGCG
TGGAGATATGAGTACTAACGTCAGAAATTACCGAGCACAGCTTACCGATACCTGCGTGAAGAACGGCGGAGCCCATTTTC
TTACCGAGATCGCATCGCGTGAATTTATGGACAACCTGACGTCACTGCTCAAGGCGGTGGGTCCGGGGATCTGTGAACCA
AGAGGTGCGCTCCAAGATTCTGGAGCTCATCCAGTCTTGGGCCTCCGCAACCGAGAAGCGGTACGACCTGAATTACATCG
GCGAGGTGTACAAGACGCTGCAGAGGGAGGGCTTTCAGTTTCCCCCGCGCACTACGGTTTCCAGCAGCATGATAGACAGC
AGTGCGGTATGTTCAGGTGTAGCTGTCGCTTTTCTACATGTGTTAATGAGCCGGCTGCTAACCCGTCTTCCATATGGCAC
AGCCTCCCGAGTGGATTGATTCGGACGTGTGCATGCGATGCAGGACTGCCTTTACCTTTACGAACCGGAAACACCACTGT
CGAAACTGTGGTAACTGCTTCGACCAGCAATGCTCGAGCAAGGTGCTACCTCTGCCCCATCTCGGCATTCTGCAGCCGGT
CCGCGTGGACGACGGCTGCTACACGAAGCTGACCGACAAGTCGTCGCGCGGAGGCCCCGAAGCTCCTGGAGGCGGCGCCG
GCTTTGCCTTTTCCCCGACAATGAAGCCAAAGACATCGGCAATGCAGCCACGAGATGCGCGGGTTGAGGACAGCTTCGAC
GAGGATCTGAAACGGGCGCTAGCTATGAGCTTGGAAGAGGTCCAGAGCCACTCACGGGGCTACGTCAAGTCAGCTACGAC
GGACGCGTCTTCTGCGCCCGCCAAGATCAGTGGACAGCCAGAGGCGTCCTCGGAACCAGTGCCATCGTGGAAGGCAGCTG
CAGATAAAAGCCCAGCAGAGGAGGAGGACGACGACCTCCAAGCCGCGATCGCAGCGTCTTTGGCAGACATGGAGGAGCAG
AAGAAGCAGCATACAGCGGCTCTGAAGGAGCAGACACATGGTGCCAGCAGCGCGCCTCTAACAGCTCCCTTTACGCTGCC
GAAGAATGACTACGAGCTGACGCCGGTGGAGGCCGAGAACATAAATCTTTTCTCCACCCTGGTTGATCGTCTGCAGACAC
AGCCTCCAGGCACGATCCTGCGGGAGCCCCAGATACAGGAGCTCTACGACAGTATTGGCGCGCTTCGACCGAAGCTGGCG
AGGACATATGGCGAGACTATGAGCAAGCATGGTGCGTATATCTGTCTGATCGTATGCGCGAGAGCCAAATTTCTAACAAG
GGCGCGATGGCCATGTTGCGACAGACACTCTGCTTGACCTGCACGCGAAGCTATCCACTGTTGTCCGGTACTACGACAGA
ATGTTAGAAGAGCGCTTGTCAAAGGCGTACAACCAGCACAGTCTCGGCGGCTATAACATGCCAGGGCCTCGCCAGCCGTC
CATGGGGTATCCGTTGCTAGGCGCCACAGCACCAGGCAGCGCAGGCCCAGCAGAAAGCTTCTACACGGGCGAGGCTCCTC
CGATCGGCTATGGACAGGCACCTCAACCTCTGTACGCATCATACGACAAGCGAGGATCATATGCTGCTCCCCCAGCAGCC
AATTCGTATGCGCCGCAGCTGGACCAGATGCCACCTAGATCGGACAGTTGGAGAGGCTCGGTTGCGTATGCTCCAGGCCA
GGGCCCATTGCCATACGCAGCACAGCTGCAACAGATGCCGCTGCAGCCACAGCCAACTGGATATGCCGGTGGCGAGCCGA
CAGCTTCTCAGCCGAATGCCCCGCAGCCGAGTGCGCCCCAAGATGACAGCGTCTCTACGCCGTCAGCAGATCCAAATGCG
GCGTTCTACTTCAACAACGGGCCATCGGCGCCGAGCCAAGTCCCATCCCAACCCCAGCAGACCCAGTCCCAGGCACAGTC
CGAACCCCAGCCGCCGCCAGCTCCAGCTGCATCAGAGCCTGGCAACCCGTCTTACCCGACGATGAGGCAGCCGTCAGTTT
ACCAGCCGTCTCAGCCACAGGCATCTACGGCAGCGCCAACTTCACCGTCGACACAGCATCAGATGCCGTCAGCGCCATAC
TGGTCGCACCCGGCGGCACAGCACCAGCAGGTCCCTGCGCAGTTTACGGCTGGACTGCCGCAGCCTCAACACCAGTACCA
GGCGCCTCCGCAGGCCTGGCCGCAGGTTCCGAACAACTACAACGCATTCCAGCAGGAAAGCTTCCCGTCGGCGCCCCAAC
ACGCAATACAGCAACCGGTGGTGGAGGAGAGCCTGATCGACCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62