GenePrediction:GLEAN_2890 Details

Name: GLEAN_2890
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4007937..4010025 (+ strand)
Length: 2089
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4007937..4008261 (+ strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_140:4008318..4008504 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_140:4008572..4008972 (+ strand)
Length: 401
Type: CDS
Source: GLEAN
Position: GCSC_140:4009046..4009171 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_140:4009256..4009341 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_140:4009394..4009480 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_140:4009534..4009650 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_140:4009867..4010025 (+ strand)
Length: 159
>GLEAN_2890 class=GenePrediction position=GCSC_140:4007937..4010025 (+ strand)
ATGGGCCGCCTTGGACGTTGGACGACGCAGACGCCTGCTGCCGAGGTGCAGAGCGTCGATACGGATCTCGGCCGCGGCCA
GCATCACGACGGCTCGCGCGAGCACCTCGTGGTCCAGCCGCTCCGGTCGTGGAAGGGCTACATCTGGGACACGTGGGAGC
TGCCGGCAGACCAGCGCCGGCTGCTCTTCAAGGTCGATGCCTTCCTGCTCACCTTTGCCTCGATCGGCTACTTTCTCAAA
AACCTGGACCAGACCAACGTGACGAACGCATACCTCAGCGGCATGAAGGAGGAGCTCTCGATGCTGGGCAACCAGCTGGT
GACCAGTGCGTGTCCGAGCAGCGGATCATTCTGGGTAGAGCTGTCCACTAACACGCCGAAGGCACTTCCGTCTGGACCGT
CGGCTACGTCGTCGGCCAGATCCCATCCAACCTCCTGCTCACCCGCGTCTCGCCCCGATGGGTCATCCCCACGCTCGAAC
TCGGCTGGGGTGTCGCCACGATCGCCACATCGGCCGTCAAGTCCTACCGAGCACTCTATGCCCTTCGCTTCCTCGTCGGC
ATCTTTGAGTGCGTCTCGTCCCCACTGGCTGACCTCTGCGAACACGACAGATCTGCTGACCTTCCCTCCCCACAGATCCG
GCTTCTATCCCGGCATCCACTACATGCTCGGCTCCTGGTACACCCCCCAGGAGATTGGCAAGCGCGCCATGATCTTCTGG
CTGGCCGGATCTATGGGCCAACTCTTCAGCGGTTTCCTCCAGGCCGCTGCCTACAGCAATCTCGACGGTGTGGCCGGTCG
GTCTGGCTGGCGCTGGCTGTTCATCATAGATGGGATTATAACGCTGCCACTCGCCGTCGCTGGTTACCTCTTCCTGCCAA
ACCTGCCACAGAGCGGAGTGAAGACCTGGTGGATCACCGAGAAGGAGAACCGCCTGTCGTCTGAGCGGATGGGCGCCATC
GGCCGCGCTGGCACTACGCCCTGGACCCGTAAGAAGGTCGTCCGGATCCTTCTTAGCTGGCACACGTACCTGCTGCGTAA
GTGTGCCCATGCTTGTCTGAACTCCTGTTTCTCTTTTTTCTTTCATTCTTTTCTCTGACCGACTCTTAGCATTCTTGTAC
GTGGTCTGGAACAACGGCATCCCCCAGGTTGGCATGGGCTACTGGCTCAAGAGCTTCAATGCCAAGCCTCATCCAGTCCC
TGGCGTCACTTTTTCCGTGTCGCAGATCAACGATCGTAAGTTGGACAGACTGTATAAGGCAATATCAAAGATGCGGACTA
ATCATCCAGTCCCCCTCGCAACGACCGGCATTTTCATAGGCATGTCGCTCATCTGGGGCTGGCTGTCGGACGGGCCGCTG
AAGGGAGCCCGGTGGCCATTCATCTACATTGGTGCTGTCATCACGGTAAGCAGATTGAGGGTGCTGAGATTTGGCGCCGG
CTAACAATCCTCCGCAGCTGATCTTCTCCGTCGTCTTGCTGAGGATGCCGCTCTACTCGGACATCCACGGCCGCAAAATC
GTGTACTGGCTTAGCAACATTGGCGTAAGCAGTTCTTCGGACGATCTATTGTCCGCGTTCATACTAACAAATTAAAGATG
GGCGCGGGTCCTCTAATTCTCAGCTGGATCAACGAGATCTGCTCCAACGACACGGAAAAGAGAGCACTGCTCGTCGGCGC
TGCAAACGATCTTGCCTATGTGGTCCAGGCCGTTGTATGTTTGCCAGGTCCTCCGTTTGCATGATGAAGTTCGCTGACAA
GCTATGTAGGCGCCCAATTTTGTGTGGAAGACGACAAAGTTTCCAGCTGCCAAATCGGGATACACTTGGTCTATTGTGTT
GCAGGTTCTTTTAGGTATTACATCCCGCGTCTGTCTAGATCAAAGCCGAAACTGACAGAGAAAACAGTTGTTGTCACTGC
CACTATCCAGGTCTTGCTCTGGGTCGACAAGCGAAGAGCAGCTCGGGCTATTCCAGATCAGTTTATCGAGACAAGTGCTG
CAAGCGAATTTAAGACAGGACATGACTTGGACGAGAAGGCAACAGACTCAGCCAAGACTACGGAAGTAACGCCGACCAGT
TTAGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62