GenePrediction:GLEAN_2892 Details

Name: GLEAN_2892
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4027987..4031141 (+ strand)
Length: 3155
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4027987..4029720 (+ strand)
Length: 1734
Type: CDS
Source: GLEAN
Position: GCSC_140:4029831..4030983 (+ strand)
Length: 1153
Type: CDS
Source: GLEAN
Position: GCSC_140:4031062..4031141 (+ strand)
Length: 80
>GLEAN_2892 class=GenePrediction position=GCSC_140:4027987..4031141 (+ strand)
ATGATGGCGTCCCAGAAGAAATCGAAAATGGGCAACGGCTGGCCCACAGATCACTCCACAGATAAACCCAACGACGGTGA
CAACAAAACACAGGCAGCGATTGCAACACTGACCGAGCAACTCTTGCAGACGAAAGAGCTGGACGAGGCGTCCATGGAAA
AGTTGAAGAACAGCATTAAGGCGTCGGTTTTCGGCAATAGATATAACAGATTACTTCACGTACTCATTACTGCGCCGGAA
ACTTCAAAGTTCGATGCACGATATGCTGTACCGAGCGGACACCCAGACGGATATCGAGACGGTCAAAGAAAGGAGGACAG
GAGAGACAGCTTTTGGTCCGATGTCGTTACTGCTACGAAACCCTCGGATTCCACTACTGACAAACCAGTCTTTGACTATT
ATGGCCCGGGAACTAGATTGCTGCTCTTCCTTCACAAGCAAAAATGTCTAGAACGTCTCCTAACGAAGAAACCACAGAAG
CCGACCACTGTCGACCGCGATCTAGACATGTTGCCGGTTCATCTGGCCATGGACAGGAAAAACGAAGATTTCATGTCTTG
TTTATTAGGGCTCTTTTACATCCCAGACAAAGACAATGGCCTAAAGCAGCTCGTTCAAAAAGCCCTCGACACGGAAGGTG
ATAAGGGAAGAAATGTAGTGCATGCAGTCATCGATCGAAAGATGCAGTTCGCTGCCCTAATTGCAGCAATATGTTCCAAA
ACAGCCTTATCCAAGGTAGACGCGACAGGTCGCACGCCACTGCATCTCGCCATGTCCACAGATAGAGGTGGCCAGTCGAC
TAAGAAGATGCCAGCATCAGTCGTGTTAGGTGACTATACATCTCAATGGAGGACCAGATTCCTACCGCTAGATGTGCTGG
TCGAGATTGAAAAAAGAAAAGACGTTGACTTGGGCGCAATCTTGACAGGAATCAACAAAGACGGCAAGTCCATGTTTCAA
GATTGCCAGGGGAGCGACGTAGGTCAGAAAACTAAGATGACTACGGAGGAGATGAACGCGGAAGAAAACAGGATAGAGCT
TGAAGTTCACGGATCGGAGCCCGAAGATCGGTCAGATATTCTTAAGAAACTGAAGAAGCTTATATTCGACAAGGTCGAGG
GCGTGTCTCTCATCCAACGGGCACTTTATGGCTTCAACGGTAAGACCAAGGAGCTAAGCCTGGACATGTCGGATTTCAAC
CAGAAGACGCACAACTTCGAGTCATTTATGGAAAAGCTCAGGAAGCTGGAGAGTAACGATGACGCAGACGAGAACTACGG
CGAAGGCGATGGCACGATGGAATTCGAGGAGACGCTTCTGTTTGTGACCCTACCGGATCTCAACTACGTCACACAGATGT
GCTCCAATCAGACGATCCAGGAGCTCTTTGGCTGGCTTAAGGAAAAGAACGTGCGCAAAATCAGGAAACTCCGGATACCA
GACAGCACGACAAGCCCTCTGAGTGATGCCTTTGTGCAGGAGCACATACTTGATGCTTTTGAAATCCAGGTATTGGATTG
GCGCCGCCTGGACGTCAATCTCGACTGCATTATAAACACGGCGAGCCGCGAGCCGCGGCCAAATGCAAAGGCGTTGGAAG
AGCTGCGACTCTACTCGAGCGGAAACTGGAGTGTTTTGTACCACTGGATGAGCGATGAAGGACTGTGCAAGCTTCCCCAG
GCAAGACATCCCTACCCTCTCTTCTCAGGCCAGCTGCTGACAAGACCTTGCACGGTATAGCTCCGCAAGGTGACAATTGA
TATTGTCGTACTAAACCAGGCCAAGGTGAGCATATCGACCATATCAGGGGCTCCATGATTCATGATACTGACGTGCACAC
ACAGGGACTCTATGATAAGGCCACGCACGACCGCCACAGCAATACTGTATTGCTGTACAAGCAGCTAATGGACGAAGCGT
ATGCTAAACCGAGTCCGACAGGGGTCAGCTATAAACTCGACATCCGACCCAACGCCCACTGGGACTACCCGCTGTTGGCT
CACAACGAGGATGAGATTCCGCCGGTAAAGCACCGGTTCACAAATCAGCTGCTTCCGACAAACAATGCGCTGGACAGTCT
CAAAGAGATTTGGATGTGGACTCGCTCGGAGCTCAACAGCGTCGAGACCAGCGACGAGGAGATTAGCGAAAATGAGGGTA
TAGCTGCGGACGACTGGAAGAATAAAGCTGCTGCCCGGTTCCGGAAATATGCACTGAGACCATCGCCTAGGAGCATACTT
TCACCAATAGACTACCGGATTCGGGTGGCCGTGATAGATAACGGCACAGACCGGACCCAGCCGAGTATTCGAAACCGGAT
CGTGGCCGGCTGCTCATGGGTCAGGGCCGGCCAGCAGGAGCACCACAATCCGGAGCTGCCGTGGTGGATGGTATCAGATC
CTCATGGCACCCAGATGGCCTCTTTGATTGCACAGGCGAGCTCGTACTGCCGGCTCTACGTGGCCCGTGTGGGTCGTGGC
CGTAGTGACATCGATCCGCATGCCGCGGCCAATGCAGTCCATTGGGCTGTCCAGCACAACGTCGACATCATCTCCATCAG
CTGGACGCTCAAAGGCCGCGAAAATGTAAAGATCCTTCAGGAGGCCGTCAACGATGCCATCAGAAGCCGCACACTCGTAT
TCTGCTCAACACCCGACCAGGGCATCTACGCTGAGGCTGCCGACCGTCTCAACGGTGTCATCAGTGTCAGTGCCGCAGAC
CGCTATGGCCACCCGACCTCCAAGTCCTCCGGCGAGACCCATGCAGACGTCTACGTCCCCGGAGAAAACGTCTTTGCCCC
TACCCCTGCCTACCTTGGCAACGCCCCTACCGACGTGTCCGGCTCCAGCGTCGCCACCGCTCTAGCCGCTGGTATCGCCG
CCCTCTCTCTTCTCCTGCTGTACACCTTCAATCCCCAAAAAGATCTTTTTGACGAAGATGATGAAAACTCCGTATCAAAG
ACCAGCCCTACCCGCGGCACCTACCACAGAAAAAAAGGTATGATGAGAGTCTTTCAGCACCTCCAGAGGGAAAATCGAGG
CGTCTCCCTGTCCCGCATGTTCCCTCAAGATGCAGTGAGCAAAGAGGAGGTTTTGGAGACGCTGGCCAAGAATTGGAAGG
TTAGCACCTGGGAGAAAGACAAAGCGACTGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62