GenePrediction:GLEAN_2893 Details

Name: GLEAN_2893
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4031809..4033084 (+ strand)
Length: 1276
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4031809..4031912 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_140:4032021..4032196 (+ strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_140:4032260..4032598 (+ strand)
Length: 339
Type: CDS
Source: GLEAN
Position: GCSC_140:4032855..4033084 (+ strand)
Length: 230
>GLEAN_2893 class=GenePrediction position=GCSC_140:4031809..4033084 (+ strand)
ATGTCATCTTCCAATATAAACTCTTCGGCGGTGGAAAAGCCGCCGCCAGCCCTGAACATCCCCTCTGGCTCAACCGTCAG
CGTGAAAATCATTGACAACACCACGTGGATGTCGTTACCGCTAAGTCTTATCCTGGGGCCACACATTCCCGGACATGACA
ATATAAACTGTCCTGCGTATTCTTTTCTTATCGAACACCCATCTGGCCGCAGGATCTTGTATGATCTTGGCACTCGCAAG
GATCTCGAGAATCTTGCTCCTGTTACCGTGCGGCTCATGGACAAGCCTGACTGGAAATATACAATAGAGAAGGATGTTGC
CGACATTCTGGTGGAGAATGGGGTCGTTCTGAATACGATCGAGGCTGTAGTTTGGTCCCACTGGCACTGTAAGTACCTAG
TGCCACTTTACGAATGGATTTAACATCATTCCTCTAAATTCACCCCTGCAGTTGATCACACCGGCAACATGAAGACATTT
CCACCGAGCGTCAATCTCATCGTTGGCTCCGGGTTTAAAAAGGGACTGCTACCGGGATATCCGACCAACAAGAACAGCCA
TGTACTCGAAGCGGACTGGGAGGTCCGCGACCTTATTGAGCTTGACTTCAACACGGATCTGAAGCTCGGCAAGTTCAAGA
CCATTGATTATTTCAGCGACGGCAGTTTCTACTTACTCGATACTCCTGGGCATGCTATCGGCCATACAAGTGCATTAGCT
CGTGTATCTAAAGGCTTCAATGGCGAGAAAGACACTTTTGTCTTTCTAGGTGGTGACTTGTGTCATCATGGTAAGTTCAA
ACGACCCCTGCGTATATGTTCTGTCTGATCATGTTGTGGTAGGTGGACTCTGGAAGCCAAATGAGTACCTCCCGCTCCCC
GCCCAAGTTTCTCTCCCGAAGCCTATTCGCCATCATTCCACCTGCCCTGGTAGTTGGTTTCAGTCGCTCCATCGCGAGAA
CACCTTGAACAAAGAATTTTATAAGATGGCTCCAAGTTTTCCACATTCATACGACGAAGCTGAGAATACTATTCACCACT
TGCAAGAATTTGACGCCGCAGATAATGTTCTTGTTATTATTGCCCATGATTCCGCGCCGCTGATGCCTTCTAGCGGGTTT
CAGTTCTTCCCCGACGGGACTTTGAACAACTGGAAGAAGGATAAACTTGATGAGAAGATCCGGTGGTCATTCTTGACTGA
CTTTTCCCACGCTGTCGAGAACGGGCTGAAACAGGAGACAACGTTGAAAGCGGGACTGGTCTTCAAACCAAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62