GenePrediction:GLEAN_2896 Details

Name: GLEAN_2896
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4056359..4058599 (+ strand)
Length: 2241
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4056359..4057016 (+ strand)
Length: 658
Type: CDS
Source: GLEAN
Position: GCSC_140:4057076..4057287 (+ strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_140:4057346..4058599 (+ strand)
Length: 1254
>GLEAN_2896 class=GenePrediction position=GCSC_140:4056359..4058599 (+ strand)
ATGGTCATCTGGCCCAGATCTTGCGTGATTGCTAGTTCTGTTGCAGCCTCCAACCAGAAGAGCGAGCAGATCGAAATAGG
GCCACTGACTGGGAGAGGAGCAAATGAGAAGACGGTCGTCCCGAAAGGCGACTGTTTGTTGATACAACTGCAGCAGCGAT
TCGCCATGTCAGAGCCACATGCAACAGGGGCCTCTGCGAGCGAGTCCGGTCCAGCCTTTGCCGATGGGGACAAAGAAGGC
GACACGCGGCCGTCTGTGTCGGGCGGCTTCGCCGACTACGATCTGGCGCGGCCGCTGGGGTCGACAGCCGGGCTGCGACA
GAGCCTGACAGCGTACGGCGACGCGCACTTTGCCCTCTTCCTGCGCAAGGCGTTCATCAAGGCGCTCGGCTACGGCGAGT
CAGCGCTGGCCCGGCCGATTGTCGGGATCGTGGACACGCGGTCGGGCCTCAACGCGTGCCACGCCAACAGCGCGGCACTG
GTCGAGGCAGTGCAGCGCGGCGTGCAGCTGGCGGGCGCACTGGCGGTGGCGTTTCCGACCATTAGCCTGCACGAGTCGTT
TGCGGCGCCGTCGAGCATGTTTCTGCTCAAACTCATGGCCATGGACACGGAGGATATGGTACGGGCGCAACCGGTCGACG
CGGTGGTACTTGTGGGAGGTGGGTTCCTTGTTCTTGTTCTTGTGCTTCTCGCCCTTTTCTCTTCCGCTGACAGACAGGTT
GTGATAAAACTACCCCGGCCCAGCTCATGGGCGCCATCTCGGCCAACAAGCCGGCCGTCCACCTGGTGACGGGACCGATG
CTGCCGGGCAGCCATCGAGGAACGCGTGTGGGCGCCTGCACCGACTGCCGCAACAACTGGGCGCGCTACCGTGCCGGCGA
GATCGACATGGAGGACATTGCCAGCCTTAACGAGGAGCTAGTGCCAACGGTGAGTCTGCCGGCCTGTCTGCCATTCACAG
CTCTTCTGACAGCCCACAACGGTCTAGTCAGGCACCTGTGGCGTCATGGGCACGGCCAGCACCATGGCCTGTCTTCTGGT
TGCCCTGGGCATGATGCCGATCAACGGGGCCACGGCACCGGTCGTCTCAGCTGGCCGTCTCCGTGTAGCTGAGCAGACAG
GCGAACTAGCCGCTCGGCTGGCCCGTGAGAGCTCGACGACAGCTTCTCGTCCACAGGACATCCTCTCGCGCGACTCCATC
CACAACGCCCTGACCGTGCTGCAGGCCATTGGCGGATCCACCAACGCGATTGTGCACCTGCTGGCCATTGCCAACCGGCA
TCCAGGACTCGCCGGCACCGTCACGCTGGCCGACCTGGATCGAATCGGCCGCTGTACGCCGCTGCTGCTGGACCTGAAGC
CGAGCGGGGCCGGTTACATGACAGACTTCCACGCTGCTGGTGGCATGGCGGCCCTGCTGACGGAACTGCGGCCATTGCTG
CAACTGGACGCCCGCACAATCACAGGCCAGACGCTCGGCGAAGCCCTGGATGCAGCGCGCTTTCGGCCCTTTGCCCAGAC
AGCCATCCGGCTACTGGCCTCACCGCTGTACACGTGCTCATCGCTCGCTGTGCTGCACGGCAACCTGGCACCACGCGGCG
CCGTACTCAAGGCGAGCGCGTCCAAGGACCGGCGGCTGCTGCAGCACAAGGGTCCGGCCGTAGTGTTTCGCTCGGCCGCC
GACATGGCTAACCGGCTCGATGACCCTAACCTCGACGTCACCCCCGATAGCGTGCTCGTTCTTCGTGGCATTGGCCCCGT
CGGCCATCCCGGCATGCCCGAGGCTGGCCTCATCCCCATTCCCCGAAAGCTCGCCGTCCGGGGCGTTACCGACATGCTCC
GCCTCTCGGATGGTCGTATGAGCGGCACTGCCGGCGGAACGATCCTGCTGCACGTCGCCCCCGAGGGCGCTGACCCCCGC
TCCGTCCTTGGAATCGTGCGCGACGGCGACATTATCCGCTGCGACCTCGCGGCCCGGCTGCTCGCCGTTGATCTGTCTGA
CGAGGAGATTGCGCATCGCCAGGCTGAACGGGTCCAGGACTGGGCTCAGACGGCTGCTAACGACGACAACGACGACCACC
ACCACCCAGAGCCCTGGATCGCTCGCCAGACCCTCCGGGGCTACCGTGGGCTGTACATGCGGGAGGTCAACCAGGCAGAC
GAGGGCGCAGACTTTCGCTTTCTGACAGCAGAGGGACCGGGCAGGTCTGACAAGACAGCTGCAATCGTTGCAGGACGGTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62