GenePrediction:GLEAN_2897 Details

Name: GLEAN_2897
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4062073..4063096 (+ strand)
Length: 1024
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4062073..4062139 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_140:4062188..4062713 (+ strand)
Length: 526
Type: CDS
Source: GLEAN
Position: GCSC_140:4062769..4063096 (+ strand)
Length: 328
>GLEAN_2897 class=GenePrediction position=GCSC_140:4062073..4063096 (+ strand)
ATGGAATCCGCTAACCGCCGCGAGGACCAGCCCGATGCCCTGGCAGAAGGCCGGCGCATCTATCTTGGTGCGATCTGCCT
TTTTTCGTTTGCGCTAATACGTCTAACCTGTACAGGAAACCTACTCTACTACGTCAAGCCGCAGGAGATTGAGGAAGCGC
TTACGGAACACGGCTTCGGAGACTACACCCAGATCCATCTCTCGGTCGACCCTGTCAGCGGCCGCAATCCGGGCTACTGC
TTTGTTGACTTTGAGGAGCGCGCGACGGCTGAGAATGCGATCGCGTCGCTGAGTGCTACCATCCGTGGTCGTCCGCTCAA
GGTCGGCCCCTGTCGTCCCAAGGAAGAGCGCCGGACCGGCCGCTGGGGCCGTGACGGGGAGCGTGATCGTGATCGAAATG
GTGACGGCGCAGAGCGACAGACTGCCTTCCAGCGATGGGGCAACTGGAAACGGTCGGATGCCGAACCCTCGGATAGGCCA
CAGCCTCCAAAGGACCACGGCCCTTACGCCGCGCTGGACCATTTTGAAAACGTCTTTGAGCGCCAGCAGAGCAACCGGCT
GTACATTGGCGGGCTCGGCAAGATGGTCGACCAGGAGCAGAACAACGACGAGATCCGAACACTGCTCGCCGGCTACGAAC
CGTGCGTTGTCTGTTGCTTTTTTGTTGTCTCGGGCATCCTGCTGATCATGCTATAGTACCGCGGTCGGCAAGCGGGTCAC
TGCGCATCCCACGCCTACGCCGAAGCCGGGCAATCACAACTACTGCTTTGTCGACTTTGCCACCCCGGGAGAAGCCGAAC
AGGTGATCAATGCGTTGAATGGCAAGCCGTACAATGGAGACCGTCTCCGCGTATCGCATGCCCGTGGATCGCCGGAAGGG
TGGAAACAGAAAGGCCCGGAGTTGCGATACGTCCCGCGCGTCACGACGACTGACGACCCTTCGTTCTCGAAGCTCCGTCG
CAAGGATTATGGCGTCGCAACGGGACGAGCTCTTGAGTCCAGCTCGTGGCGCCGACAAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62