GenePrediction:GLEAN_2899 Details

Name: GLEAN_2899
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4068954..4071292 (+ strand)
Length: 2339
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4068954..4069288 (+ strand)
Length: 335
Type: CDS
Source: GLEAN
Position: GCSC_140:4069395..4070108 (+ strand)
Length: 714
Type: CDS
Source: GLEAN
Position: GCSC_140:4070275..4070641 (+ strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_140:4070720..4071292 (+ strand)
Length: 573
>GLEAN_2899 class=GenePrediction position=GCSC_140:4068954..4071292 (+ strand)
ATGGGTGAATCTCCAGTCAACCTCGCAGCACACATAGATTTTATCGGCCACGACCGCAGAGAATACGATTTTGGGATGGT
GGCCAAGAGGCTACGCGATATCAAAAGGGACATTAAAGACTTATTTCATGATCCAAAGGACGAATTGCGGACATATCGTG
GAATTGCCGGCGCACTGAACAACGATGAGATAGATTTTATCCGGCGTACGAAAGCACAAAAGAAATTTTCAGAGTTTCTT
TATGAGAATCTCAAAAGACACAACACCTGCCCCGGAACCCACAAAGCTCGGTTGCACCTCTCTGGATTCGTCGACAATGA
TGTAAATATCGATCTGTATGCCTGCGAGCGCCAACGGATCCCAACTGAAACAATAAAACTCAAATTGTCAGAGGCTATAT
ATCAGGTCACTCTTCTCAACATTGGCTAACTCGTCCACTAGCATTAATGAACCTCAACCGCAGGAGAAACAGACCGCGAG
CGGCGTAAGAACCCGTTCGAAAATGAAACTTGAAAGACATACATGCCTTAGCATCGGGCCTAATGCTAATGAATTGATAC
TCTGTGAGACCCAATCCCGACATGTGAATGATTTCGACCAGGATTCCAGACACTTGCTTCCAGATCTTTTGTCTCGAAGA
GCCGACTTTAATGGCTCGGACTTGAAGATGGTTCAGCTTTTAGTAGCCTCCTCGCTTCTAAATGCAACTTTGTGGTTAAA
GCACGCAGAGCTAGATATCACTTCCATCTCTTTTGACAAATCTTCCGAGTCTACGTGGCCATGGAAGCTGGGTGTGGACT
GTACCCTTGAAGGAACTCTTTCCAACGACATACACTATGATGCTGCTGTGTCGTTTGGCCTCTTTCTAATAGAGACAGAA
AGGGGTGAGCGTATACAGCCAACCGACGAGGAACAAGATTGGGAGTCAGGTCTGTGGGCGAAGGACAGCACTCTATTCCG
TGTCCTTGGTGAATCAGGAAGCTCAGTGACGGATCCTTACAGATATATTGCTCTGGCGTGCCTGGAGATCAATGATGCCA
CGGCCGAAGTTTGCGACGAAAGATTGACCAAGGACATGTTGCAGATCGCAACACTCTACAGGCATATTTTCGCCCCTCTT
TATAAATTCGCCAGAGAGAGCTACCACCAAATATCGTATATATTCAGAGGCTCTCCCACCCAGTCTCCGAGTCTAGGCTT
GCATACCCCAGTCATTCAGAACTTGCAATTATTCGATGACGACGATAGCACACCGGACCCTATGTGAGATGCAATTTACG
TGATCCGGGCATGACTTGCTATCTAACTATGCGGACTATAGGGCCGTCACACGAGCAAGACAGTTTCGAACAGAGTTCAA
GACTTTCATAAATATGATTAGTAGTCTGGAACCGATCAATGTGTCGGATATCGAGCGCAGGGAAAAAATTAAGATAGCAG
TGATCGACAGTGGCATAGATAAAGGCGACACTATTATCGCAGAGAACATGGACCGTATCAAGTATCGGTGCGGCTTTGTC
AGCGACGCCGGAGAAGGACCGCGCTCTGGTGATTGCGAAGATGAATTAGGTCACGGCACCCATGTCACACGGCTGATTCT
GGAGATGGCCCCTGAAGCAGAGCTATATGTTGCTAAGATCTCCGACAAGAAGACCATACAGAGCTCCGACCTACATCGAC
TCGTTCGGGTAAGTCTTTTGGTATGTCGTGGGAAGATGGCGAGCGATCTTTGCTGCATACACAAGCATCCTGACAACATG
CCTTAGGCCATTGAATGGGCGTGCAAAAAAAAGGTGCACATCATTTCCCTATCTCTTGGAATAGACATGGACAACAATCG
AGAGCTTGGTCGGGCCATTCAAGCTGCCAGAGATTCCAATATCACCATCTTCGCGGCCGCGTCCAACGGTGGCGGCAACA
AGCCGAGGTCATACCCAGCAAGTCGTCCATTCGGCGTTATATGCGTCCATGCCAGCGACGGCCTGGGCAATAAAGGAGGT
ATCAACCCGACTCCGCTTAAACGTGGCGACAACTTCTTGACCCTCGGCATCGGTATTGAATCAAAGTGGAAAGGCAACGA
TGTTATAAAGTCTGGAACGTCGTTTGCGACGCCGGTAATGGTCGCCATAGTAGCCAACGTGCTGAAATTTGCTCTACACA
AGTGCGATCTGGACAGTTACCGGTTTGACAGGCTCCGTGAGTACGATGGCGTATGTCAGATCCTGCGACTTATGGCCCGG
GAGCGAGATCAATACGATTATGTCATGCCTAATTCCCTCTTCGGGCGCTATGATGATAATCGCATAAAGCATGAGCTTCT
CAGAATTAGCGATCCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62