GenePrediction:GLEAN_289 Details

Name: GLEAN_289
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:795638..797920 (+ strand)
Length: 2283
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:795638..796305 (+ strand)
Length: 668
Type: CDS
Source: GLEAN
Position: GCSC_167:797065..797633 (+ strand)
Length: 569
Type: CDS
Source: GLEAN
Position: GCSC_167:797700..797920 (+ strand)
Length: 221
>GLEAN_289 class=GenePrediction position=GCSC_167:795638..797920 (+ strand)
ATGCCAGCACAAAAGTACGAGATCGTGCTCGACGACCAGCTGCAATGGGTCCGTGTACCTCTGCCGAGCAAGGCCGCGTT
GGCCGCAGCAGCCGAGAGCAAGCGCCAGAGGCTCTTTGAAGAACGCTGGGTGGAAAAGGCAGACTCGGACCAGCCCGACG
ACCTCGACCGCTTTCTCGAAGAAGTCAGGACCATTGCAGCCGGTGCCGTGGGCAAGAAGAACCGTGAGCTGGCGACTCGC
ACCATGCTTTCTGCCCACAGCACAGTCTGTCTCGACCATGACCGGCGTATTGCCTTTGGCCAAGTCCGCCCCCCACCCAA
GTCCATTTTTGGTGTCCGCGACGGCGGCGTCGACACGCGGCGGTACCGGCACCGGCGTCACCGCCCGGACGGAGCCCACC
TCAAGAACAAGGTTACCGGTCTTCCTCGCTGCCACAGCGACATCGCTGCCACATGCCTCGCACCGGAGCCTAGCCAGTTC
GACAGCGGCAGCATCGTGGTGGCCGGGCTGGCCAAGCTTGGCGAGTGGACGGAGTCAGCTCACGGCCGAGCCGGTATATT
CTCCGAGGAGCGTGTCCGCAGAAACCGGAAGCAGGCTTTGAGCAATGCCATGCGGCGCAGCCAGCCCAAAGGTTCGACGG
TGTATCAGGCGCTGAGGCTTCTGGTCGGGTGAGATGGGTGAGTTAGCGGTACTTACCACATCGTGGCGTTTGGACATTTA
CGTTTGGACGTTGGGGCGTCTGTCTGTATTTCGGGGTTCCATTGTATCTTGAAAGCGTTATCAAACAAACTAGTTTTTCT
TTGTCGTTCTTCCTTCCCGCTTTCGTTCCTGGCCTGCCGCCTTTGTTGACCCGGCTGCACTACTTGTTAAGGTATCTTAT
TCCGTATGTACGGTAGAGCTACTGCCTGTTCCTGAAAGAGTGGTTCTGTAGGCGAGAATATGCCGAAGTTACTCAAATAT
TGCATGTTGCCACAGGGCCACACCCGCTGCCTGGTAATCACTATTTGCAAGCGCCGCATTTGGCGCCCCTGCCGGAAAAC
CCCAGTATATTAGAACGGGCCTGCAGGGGAAGTTGACGAAAGAGAGGCAAGGACGTCTCCCCGTGCTTGAAGCCAGCGAA
GCCACTTCAATTTAGCTCAACCGAATTTCGCGATAGCACGACTCTGGACGTGCCCGTGTAGAAACAGGAAAGCGCGTTCT
GCAGCAAGGATATAGGACTGGATTGGGCTACTGCGGCAATCAGCTTTGACTCACAATACCGCTGCCTTTGTACGCAATCA
CAGGCACTTGGACGTCTGATTAGGAAACTATAGACGACACCCAAAACTTTTCCCTCATACTAATTGTTCGACCAAAACAC
GACGGCAACGGACTTTCCGCTACATCGTTGCCAAACTACATTTCTCAGGACAACGACCACTACACAGAATTCCAGTTGCA
CTTATCGCCACCATGGTTGTCATTGATATTGTCCGCCATGCCGAGGGCTGGCACAACATCGCCATCGAGAACCAAAGAAT
TCAAGATCCCGTCCTGACGGACCGGGGTGAGAAACAGTGTGACAACCTGCGGGCCACATACCCTCACGGCAAGAAGCTGA
ATATGCTAGTAGCCTCGCCGATGCAGCGGACGCTGCAGACCTGCATTTTGTCGTTCGGTGAGCTTGCTCCCAGCGGCACT
ATTGTGGTGGCCATCCCAGAGCTGCAGGAACTGTCGACCCTTCCGTCTGACGTGGGCTCGGACCCATCCGTTCTGCACAA
GCTGTTTGGAGACCAGGTCGACTTTTCGCGCGTCAAGCCCGGCTGGAACAACAAGAGCGCCGACACTCCCTTTGAGCCCA
CCATCCCCAAGATCGAGGCCCGCGCCCGCAAAGCCCGTTGCACGCTGCGGGAGCTGACGGCGCACTTGGGCGGAGACGAC
CACATTGCCGTGGTCTCGCATGGTGCCTTTCTTCACTTCCTCACAGAGGACTTTCATGGGGTGCCGCCGGAGCGAGGTAG
GACATGAGGCCCCAACACCCCCTCCTGGCGTATATATGACGTGCTAAAGCGTGAACTGCAAGCTACCGGTTGGGAAAATA
CCGAGTACCGGTCGTATGTCTTTGCGGACCCGACAGGTGCCGATGAGAACGCCACTCTTCAGGAGATGGCGGAAAGCCGC
ATAGCCCGACTCGGGCACAACGACAGCGTGGACCAGGACAGCCTGAAGAAGAACCACATCGAAGTGATCCTGGACCAAAT
GGCCCAGGTTGTCGGTATGGACAGAGGCTTCAAGTTCCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62