GenePrediction:GLEAN_28 Details

Name: GLEAN_28
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:196118..198225 (+ strand)
Length: 2108
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:196118..196282 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_179:196556..196995 (+ strand)
Length: 440
Type: CDS
Source: GLEAN
Position: GCSC_179:197058..198225 (+ strand)
Length: 1168
>GLEAN_28 class=GenePrediction position=GCSC_179:196118..198225 (+ strand)
ATGGTCATGACTTTCCCTATCCCCTTCTACCGGCAGCCACAATTGTCGATTGACACAGCCGGCCACATCCAGCAGAAGTA
CTTTGAAGAGGACGAGCGGATACTTGACGATTCTGTCCTCGACCAGAGCGCTATTGACTCGGGGCTGGAAATGTCACCGC
CAATGGTAGATCGGAGAGATTCATTTGCTATCGGTTCATCCCTCTTCTCGCCCAAACAGGAGGATTGGCAGTCTGCCGAA
ATGCAGTCCATGTCGTCCACCAACCCATTTACCAACCCGCACAGCACCAACCCCTTCATGCGCATGGATCACCAGCAGCA
GCAGCAACAGCAGCAGCAGCACCAGTTCCAGCAGCAGCAGCCCTTGAGCCACCACTCTGGGTCGTGGCCCATGAGCGCGA
GCACCAGTGCCAACTCGTGCACCGCCACGCCTGTGCAGCACTTTGATGGTCTCCAGACGGACTTTGAGGCGGCTACCGCT
ACCATGTTCCAGCGCACCCCGATGCCACTGCAGTCGTCGCCCTTTGGCAACGCTGCCGGTCCCATGAGCGGCATGTACTC
GTCTGCGCGCGGCCCTGCTCTCGGATCGACGGCCATGGCAACATCGTCTTCGATGCAAGGCAGTGGCAGCACCATTGTCA
ACGCCAGCGGAAGCGGCGTCGGCGCTACCATGTCTCGGAAGATGTTGCACAGTCCGACAATCCGGACCCACCCGGAGCTG
CGCCGTGGCGATGGCATCCGCAAGAAGAACGCTCGCTTTGAAATCCCGGCCGAGCGCAATCTCAACAACATTGACCTGCT
TATCTCCCAGACGACCGATGAACAGGAGATCAAGGAGCTCAAGCAGCAGAAGCGTCTTCTTCGCAATCGTCAGGCAGCGT
ACGTCACTTCCCCACCTTCTCTCGCTTCTTTCCTGTCTTACTAACGCCACCACCTCACAGTCTTGACTCGAGACAGCGCA
AGAAGCAGCACACCGAGCGACTTGAAGATGAAAAGAAGCATTACACTGCTGTCATCAACGACATGGAGCAGGCCATGGAG
CGCCTCAAGCTCCAGGTTCACGATCTCCTGGAAGAGAAGGAGCAGTACGCGGATTACTTGAAGACCCTTGATCTCGACAA
GGAGGACATGGTTCGCCGTCACACCATTGAGACTGGCGAGCTTCGCAAGAAGATCAGCATCCTGTCCAACCACGTGCAGA
CGCTGGAGAATGCGGCTGTCACCATGCCCAACGGCCAGGTCGCCTACGCCGACGGCACGAACGCCGGAGTTGGTGTCGGT
GCATATGGCGAGATGGAGGGCCTCAGCATGGGCGGCACCTGGGAACACGTCACCCTGTTCTCTGACATGGCCGGTGCGGA
GCAGCAGCAGCAGCAGCAGCAGCAGCAGCCTCCTGCCGAGATTAAGCAAGAGATGCAGCAGCTCCTGCCCGCATCGCGCA
AGGCAGCCAACAACGCCATGGACGCTGCCGGCGTCGCCACTGGTTCAGTGGGCTCGGAGCGGCCTGCCAATCAGGGCGGC
CTGCTCTTCATGCTCTTCCTTGTCGGCGCCTTTGTCATGTCGAGCCGCCAGGCGCCCAGCATCCCACGCGTGTCGGAAGA
CGTCCGCGTGGCGTCTGCTGCACTCCTGGAGAACGTGCTCAAGGACGCAGGCGTGCCTTCGAGCACCTCGTTTTCTGCCG
CGGGCCTGACGGATGCTACCGCTCTGTCGATGCCCTCGCAGTCCGCCTCTGCTGTCACGTCTTCGTGGGTGGCGCAAGCA
GATGTCGCATCCAACGGCGTCGTGGAGCCGTCGATGCTTGGCCAGCTCTCTGACCAGCTGATCCAGCCGACTGAGCAGCA
GACTGCCGAACACATGTTCTCGATGTCTGCCGCGCAGTATAGCAGCGTGGTGCAACACTACGAGCACCCGCAGCTTGATC
GGTCTGTTGCTGCCGGAGGAAGCGGTGCCCCGAGCCGGGGACGCCGCAATCTGGCCGAGGCTCTGGCTTCGATGCGCGTG
AACAGCAAGGCAGAGGTGGTGACACGATCGCTGCTTTGGGACCAGATCCCGAGCGATGTCGTTCATGCCTTTGCCAAGAT
GTTTGCCGACTCACAAGGCCAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62