GenePrediction:GLEAN_2900 Details

Name: GLEAN_2900
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4080203..4083268 (+ strand)
Length: 3066
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4080203..4081835 (+ strand)
Length: 1633
Type: CDS
Source: GLEAN
Position: GCSC_140:4081889..4083056 (+ strand)
Length: 1168
Type: CDS
Source: GLEAN
Position: GCSC_140:4083196..4083268 (+ strand)
Length: 73
>GLEAN_2900 class=GenePrediction position=GCSC_140:4080203..4083268 (+ strand)
ATGGAGAGTTCCGGGTTTCCACTGAAATCGACGGATGAGCTGATCCGACGTTTGGAACAGCTCCGATCCGAGCTGAACAG
CGCAGTCCAGTCTCCTCCCGACCCTGATATAATAAACTGGTCGGTAGAAAAGCAGGATGAACAAAGACAAAGCCAGGAAC
ACAAGAAGAGACAGATGAAGAAGGAGGAAGCTGCACTCTGTGCCTTGCTCGAGTCCATGGTACAGACCTTCGACCACACG
CCCATCGTCGCAAGACTGTCCTACTACCCCGAAGCTGCTGCCATATCGCCCTATGTCAGTGGTGGGGGGTACAATCGTTT
GTTCACAGCTCTTGCAGATTGTTTGAGCAGCGGTGTCAACGACGGCACTATCCCAGATGTCCAGCTCCTTGCGGCCCTCA
ACACTGTACTGCAATACCCGCGAGAGCTCCAAGACCTTCCTCTCGGTTACGTCATCCAACACTTGATGCAAAGACTCAAA
ACATCTGTTGAAAATGCCAGCGAGCCTGTCAAGTATCGGCTCATCCTGACGCTTTCCAACATTCTTGATGCTATGAACGA
TGTGAAAACTCGTGGTATCAGTGAGCTGAACATCGTCCAACCCTTGATGGAGATACTTGGCAGCATCTCAAAGCAAAAGG
AGCTGCGCCTAGCTCAGGCAGCTCAGTATGCACAGGCAGCTCTGCGCGTCATTCCGACCGACGTCAGTCCGTGGAAGACG
TTCTTGGACAAAGCATACAAATCCGTTGAAGGTTCTGCAAAAATAGCTGGCGCAGTTTCGACCTTGGACCCTTCTAAACT
CCTTCAGGGGGTTGAAAGTCTCGCAGAAGTCGTGCAGCTGATTGCATCAACTTTCGAAGCCGTGGATTCTGTAGCAAGCT
TAGCCGAGGACTTCTCAGGCATGATCAAGGGATCGAAGTATGCAAAAACACCGGCAAAATGGTATGTTGCCCTTCGCTAC
ACCGACTTGTTAATTCGTGGGCGACGTCCGGAGTACCTGAAATCCGTTCTTGAAAACCCTGGGTTCCCGTGTCGGGATGA
TAAGCAGTTTTTGTGTGGTCTTTGTGCGCAGTTCGAGCGGGCAGTCGAATCCGAGACGCTGTCGCGAGATGGCGAGATGG
CCAATATTTTGAAAACATTTTTGATGTCGCAGTGCACAAACACAAGGGACGATGTTGTCCGAGAATGGGTGCACACTGTT
CTAGGGGGCGAAGTGCAAGTTCAACCGCGCAAACATCATATTCGTATTTGGAAAAATGGCAAAGCACCGGCACATACCAC
TAAGATCGAGTACAAGAAAGCCAACCCCAAAACACCCGGTATCGCGCTCCTGAAAGACTCTTGGAAGACCTGTCCAAAAG
CTCTCTTGTTTCATGCCGACAAGATGCTCCGATCCCATTATACGGATGAAAGTCTGAAACAACTCCAGATCGAGCGTCTT
GATAGCAGCATTCTGCTGATGAGCAATTGTTACATCAACCTGACGATTACGGAGCGCAATGATCGAATGATGCAAGCTGG
AGACCGGCCTGAAGATGAGTCGCGCTTCTACCTACGCTCCAAGAAGGCCCCATCCACAAATGCCGTTCTACTGCCGAATA
TCTTTCAGAAACGGCAATCATCATCTACTTCAGGTCTGTTTCATCCATACTAATTTTACGATTTTTTCCAACCTAATGTA
AAGCAGCATCTACCTGTCAACGAATTATCATCCGCGGACAGGCTGGCGTTGGCAAAAGTACGCTCTGCAAAAAGATGGTG
TACGATTTCGTCAACCATGGAATGTGGGCAGACACCGTCGATCGGGTCATTTGGGTACCCCTCAGAGAGCTCAACGGGAA
GAGCAAACACGTTGCGGACATGAAGGAACTATTGAGACAGAAATGCTTTACCGATCCGCAAAGCCAGCCGTTTCTTGACG
CTTTGTGGGCTGCTTTCGAAGAGGACAGGACTAGGACGCTCTTCATTCTGGACGGCCTGGATGAAGTGGCTGAGCTCCTT
GGGAACATCGAAGATAAGCACAGGCTGCTCTGGACGGTTCTAAACCAGCCTCGCGTCATCATTACCACACGACCACACAA
CATAAACAAGGACGCTGTGAAGGACATCCATTTGGAGACGGAGACGGTTGGATTCTATTCTGGCCAAGTGGAAGAGTACA
TCACGGCTGTCTCACCAGCCAATGCCGAACAAATCCTTGCGTTTGTGAAAAGTCACCCAGTCATTCAAGGGCTTTCAAGC
ATTCCAATTCAGCTCGATGCGATCTGCTACAGTTTTGGGTCGCTGACGAAAACTTTAGAAACGATGACGCAGCTGTACGA
GGCAATTGAACTAGCTCTGTGGATCAAAGATATCATTCGACTAAGAAAGGAAGTTGTAGGAGCGTCGATTCCAATCACAA
AGTATGCCGCTCAGAGCTCCACTCCTACTGAAGTGAAGTCCATCGTCCAGGGGGAAATAAATGTCCTTCAGGCTCTTGCC
TTTGTCGGCTTCCAACAAAACATGCTCGAGTTCGATCGGGATTTCTTGAACACGTTTTTCGACAAACAAACAGGATTCGC
AACACTCACAAACCACCTTCCAGCGGCAAACAGCGCATTGTCTAGTGACTTGGGAAAGCTCTCATTTCTTCGGAGTTCCG
ACAAGGGAGAGACCCTTGAATCACGAAGCTATCATTTCATTCATCTCACCTTCCAAGAATACTTCGCGGCACAATACTTC
GTCCAGCACTGGCCAAGTAAGAATCTTCCGTACTATCAACTCAACGACGACGAGTCCAACGACATGGAGCAAATCAGCGC
CGAGGAATTTCTTTTTCGGAAAAAATACGACCGGCGCTACAATGTCTTTTGGCGGTTTGTCGCCGGACTACTCAAAAACG
ATCAGCAGCTCTGCTACTTTTTCAAAGCGGTGGAAGATAAACCGCGCGACATGTTGGGAATAGCGCATCAACGCTTGCTT
ATGCGCTGCTGGAACGAGGTATTTCTACAGCAGAACTCATCACCGCGACTCACAACTTTCCAAAATAACCTGGACCACCA
ACTGGAACAGTGGCCGCGACTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62