GenePrediction:GLEAN_2902 Details

Name: GLEAN_2902
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4091318..4093184 (+ strand)
Length: 1867
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4091318..4091533 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_140:4091599..4092739 (+ strand)
Length: 1141
Type: CDS
Source: GLEAN
Position: GCSC_140:4092800..4092884 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_140:4092941..4093090 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_140:4093145..4093184 (+ strand)
Length: 40
>GLEAN_2902 class=GenePrediction position=GCSC_140:4091318..4093184 (+ strand)
ATGTCTCGCGATATCAGCCCACTGGAAGCAATCAGCCTCTCGGACCCGGAAAAGTCTCTGGGCGAGAAGGAAGGGTTCCA
GGTCCAGTCGTCGCCGTCTCGCCCAGACAGCATTGTCTCTGCGACCAGCCTGCGCCACGATGCGACCCATCGTCAGCTCA
AGTCGCGTCACATCCAGCTCATGGGCATCGGCGGCACCATTGGCACGGCTCTCTATGTACGTCAGCTGTGCGCATCGGTG
CAGACAGCAGAGACAAGGGCCTGCCCACTAACGGCTCGCAGGTGCAAATCGGAAAAGGCCTTCTCAACGGCGGCCCTGCC
AGTCTCTTTCTGGCCTTTACCATCTGGTGTACCTTTATCCTGGCCGTGACCATGTGCATGGCCGAGATGGTGACCTTCAA
CCCGATCTCGTCGCCATTTATCCGCTTTGCCGGCCGCTACGCCGACGAGGCCCTTGGCTTTGCAGCTGGCTGGAACTTTT
TCGTCTTCGAGGCCGCACTGGTCCCGTTCGAGGTCACGGCTGCCAACCTGATCTTGCACTTCTGGACCGACGCGATCCCC
ACGGCTGCCGTGATCGTCATCATCATCGGTCTCTACGCCCTCATCAACATGCTGGCGGTCAAGTGGTACGGCGAGGCCGA
GTTCTGGTCGGCCGTCGGAAAGGTGATTCTAATCGTCGGCCTGATCGCCTTCACCTTTGTCGTCATGGTCGGCGGCAATC
CGCATCACGACGTGTTCGGCTTTCGGTACTGGAAGAACCCCGGCTCATTCACGGAACTGTACTACGAGGGCAGCCTCGGC
CGCTGGCTTGGCTTCCTGCAGTGTCTCATCCAGGCTTCCTTCACGATCGCAGGCCCCGACTACGTCTCCATGGCCGCCGG
CGAGGCCGAGAACCCGCGCAAAGTGATGCCGCGCGCCTACAACGCCGTCTTCTACCGTCTGACCGCCTTCTTCGCCCTCG
GCTCGCTCTGTGTCGGCATCTTGGTGCCCTACAACGACCCCGAGATGACGGCCGCCTTCCGGGATGGTCAGCCTGGCGCG
GCCGCCTCGCCCTATGTCGTCGCCATGAACCGGCTGCATATCCCTGTTCTGCCGCACATTGTCAACGCTGTCGTCCTACT
CTCGGCCTTTTCGGCCGGGAACTCGTACGTCTACTGCGCCTCGCGCTCGCTTTACGGCCTCGCTCTCGACGGCAAGGCCC
CCCACTTCATGACCTGGTGCACCAGGAGCGGCGTGCCGATCTACTGCGTCATCGCGACCCTGCTCGTCGCCCTTCTGTCC
TTCTTGCAGCTCTCCAATAACACGGCTGTTGTTCTCAACTGGTTTGTCTCCCTTGTCACGGCTTCGCAGCTCCTGAACTT
TGCCTGCATGTGCCTCACCTACATCTTCTGGCATCGGGCACTCAAGGCGCAGGGCATCAGCCGTGAGTCTCTACCTCATA
GAGCACACCTCATGCCATATGCTGCGTGGTACGGATTGATAGGCACGTTCATCATGGTCTTTGTAGGAGGCTATACAGTG
TTTCTGCCTCTTGATGGCTACTGGAACGTTCCCGACTTTTTATTCTCGTGAGTCGTTCGTAATAGGTATTTTTCCGCAAC
ATACTGATGGTGTGGAAATCCAGATACACAATGGTTGGTATCTATCCAGTTTTGTACCTTGGCTACAAGCTGTTCCGCAA
AACAAAGATACAAAACCCCCTCGAGATCGACTTCCGCAAAGACCAGGCGGCTCTGGAAGAATACGAGCGCAACTATGCTC
CTCAACCACCAACGTGAGCCAAGTTCTATTCGAGAACCATATGAACCAAACTAACACAGCTACACAGAACTGTATTTGAG
AAATTTCTCGACATTGTATTTGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62