GenePrediction:GLEAN_2903 Details

Name: GLEAN_2903
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4099481..4103478 (+ strand)
Length: 3998
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4099481..4099567 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_140:4099621..4099758 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_140:4099813..4100416 (+ strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_140:4100470..4100582 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_140:4101034..4101205 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_140:4101277..4103403 (+ strand)
Length: 2127
Type: CDS
Source: GLEAN
Position: GCSC_140:4103474..4103478 (+ strand)
Length: 5
>GLEAN_2903 class=GenePrediction position=GCSC_140:4099481..4103478 (+ strand)
ATGGCAACTTTTCCAACGACCCTGCCAGCATCATGGTACACGAGCAAGGCCATTGGCGACCTGGAACGACGAGCTGTATT
TTTGCAGGTGAGCGAGAGTGTATGTGCCTGCCCATTATACCCGGCTGACGAGGTTCTCAGACGTGGATACTGCTGGGTGC
AGTCACTAAATGGCCAAATGTGGGCGAGCGGTACGCAAACAGCTTGGCCGAGGTCGAGCTGTTTGTGCAGCGGGTCTCTG
AAGACTGGCGAAGCATACAAGTATTTTCTGCAGCTGATGTAAGTTCGGTTGTGTGGCTGTTGTGCTTCATTGACTGTAGT
CTAACTATTCAGGGCTCCGCGATCCGCAGCCACCTGACGGCCACGGGGCTGCTCTTTGTCACGCTGTCAGAGGCCACGGT
CAGCTTCGACGACTTCTTCCCCGGCCTAGAGGAGCTGATAGGCCAGATTGACTTCCAGCAGTTTGCGCCCCGGCGCAGCC
TCGAGTACGAGGGCCGGTACAACTGGAAGGCGATGATGGACGGCTACCAGGAGTGTCTGCACTGCCCGTATGCACACCCG
AGCTTTGCCAAGGTGTATAGGTTCGCCACGTACCGGGTGCTGAACCGGCACAACTACTCGCAGCACATTGCAGCGACAGA
CCGGCCCAACGACGGTCTCTTCCTCTACTTTTTCCCCAACTCGACGCTGAACCTGTACGGCGGCGGGATGTCGTCGTTTC
GGGCGTGGCCGACGGCCGATCCGCGGCGGTCCACAGTGGACTTTGATTACTACCACGTCGCGCCCGAGAGCTCGGACACG
TTCGACACGTACTTTCGGTTTGCGCGCACCGTCGCGGTCGAGGACCACGATCTCTGCGAGAAGGTCCAGCAGAACTTGGA
CGTAGGCATCTATACGGAGGGCATCCTCAACCCGGACAAGGAGAACGGGGTGGCATGTGAGTCTGTATCGTCTACAACGG
ATACGTTTGCCTGCTAATTTGCTCTCTAGATTACCAGAGCCGCGTGCTGGAAATGTGTGCTGCCCAGTACGAGAAGGAAA
AGGAGAGTTTGGCGGGGGATAGCGTTGCCGTGAAGCGAGAAGAAATACCGTCGGTTTTTGAGGTAGCAGCTTCGTAACTG
TAAGGCATAGTGTACATGGTATATAGAGCTATCCCGACGAGAGCTGGTGGTCGATCAGTGCTGTTGATCTCTCGTGTTAT
AAGGCCACAGTGCAAACACGTTTCGTACAGTGCGTCTAGCACATGCCAACGCATTTCAACGCACGGGCCACTTTCCAGCC
CCGCCTAATGTACGTAGTCCCGTGCAGATCAAAAAGTCTGGCCCCTCGAACCAGCGACGTATCTTCGTCCGGTTATCGGT
GTCGAGGATGTGGACGGCGCCATTGGCCAACGGTGACAGTGCTAGGACGTGAATGGAAGTATTATCCGGCTCGTGGTTAT
CTTCATAGGCCTCAGATAGCTCCATGTCTTGACCGGTCCGTCTGGCTACCAGAGTCAGAAACACAGCAAAATGGATGTCC
TTTCCCGTCAATTTCTCGCTCCTTCTGTGCCAGCCAGAGACCGCAGATAGGAATGTCACCAGTATTAGAATTACAGCTAT
GGAAAGTCCGTCGTCGGCCGTTGCACAGGCAAACTGGGCAGAAACGCGCAGCTTCGACGAGCCAGCGAAAAGCGCGACGA
CCAGAACGCCAGAGCCGGCGTACAGACATACCAAGAGCCGAAATGGTGGGTTGGATGACGTTAGGCGCTGATATGGCGGT
GTGGTAGTGCTGTTGGGCTAGCTAATCGACGTCTAGGATGCGTGACCTGCAAGGCAAGACGGCGCAAGTGCGACGAGGCC
AAGCCGTCGTGCAGCCAGTGTGCGCGTCGCCGAGTGACCTGTGGTGGCTACAGCAGCGGTCTGCGATGGAAGGAGTTTTC
GCAGCCCGAGCCAGCGGCGGTTCTGTCGGGACGCAAGGGCGCGGCCAGGAGCTCGCGACAGCGGAGAGCAGCCGCGGCGA
GTCCGGGATCCCATGGCGGCCAGACGCCTCCACGACTGCCCGACACGACTGCAAACATTCTGTTCGCCGAACCGGCCGAG
ACGCTGGAGCCGCTCGTCGACATGGACCTGCTGCTGGCCGACATCCACGCGACGCTTGAGGGGCCGTCCGGCCTGGAGGA
CAACCTGCTGGTGGACTACCGGCTGGTAAATGGCGATGAGGACGACACAGCTGGGCTTCCGTCTTTTTTCCACGGCAGCA
CAGACGCAGAAGCCGAGATGGTGGACCTGGATCTGGACCTGCTCGAAGCCGAGGATGACGACAGCACGGCCACGGTCACC
GGCTGGCAGCTGCCTTTTGAGGCCATGGCCACGGCTGCCTCTTCGTCCTCGTCTTCGGCCGTGTCATCCTCCTCGACCAC
TGCTAAGCTGGCCCACACGCTGTACCAGCATCCTCGCTTCCACAGCGGCAGCCCAGAGCACATTGCCTTTCTCTTCAACC
GGCGCATCTGTGAGGTGCTCTGCATTCGTGACGACGGCACGGCCGGAAACCCGTGGCGACGCATCGTCTGGCCGCTGGCC
CAGGACCACGCCGCACTCTACCACGCTGTCGCTGCCATGACCTGCTTCCAGGGTGCCAACCGGCTGCCGCAATTTCGCGC
CGAGGGCTTGCGCCATCTCAACACGAGCATACAGCAGATGTACGGCAGCCGAGGAGAGAGCAACAGCTCCAACAGCAGCA
ATATGCGCCTCGAGGTCGCCCTGGCCGTCACTCTTGTCCTCGGCTTCGCCGAGACTTGGTACTATCCCCGGTCATCGACC
GGGATCCGATTCGTCCAACGGGCCAAGGGGCTCCTACAAACCGCGCTCACCGACAAGAGCAACGACAGCTCGTCCGACCT
GATCTGCCTCCGCTTTCTCGCCAACACTTGGGTCTACATGGACGTCATCTCGCGCTTTACCTGTCACGGCCTCCAGACGG
TCGACACCCGCTTCATGGCCGCCTGGCGCCGCCTCGACCCGCAGCCACACACGGCCACACGGCGGATGCAGGTCGACCCG
CTCATGGGAACGGCCGCGACGCTGTTCCCGCTAATTGGCCGTGTGGCTGACCTCGTCAACCGCGTGCACGGCAGCACGGC
GACGTCGTCATCGGAAGATCCTAACGACCTCAACCCGCCCGGCCTCGTGGCTGAAGCTGTTGAGCTCAAGATGGCCATCG
AGCGCTGGCGGCCGGCCGAATTGACAGACGAGGAGGACGTCGTCGAGGACCTGAATGCTGACTCAGCAACCCCACCCTCG
TCCTCTTCGGCTTCCGACCTCGTCCAGACGGCGGATGCGTACAAGTGGGCATCTCTGCTGCTGCTGCACCAGGCCGTGCC
CGAGCTGCCACGGCCGCGCACCTCACTGCCTGCTCGGCTGGCCCGCCGCGTCCTCGTTATGCTGGCCACCGTGCCGCTCG
GCTCGCGTGCCGTCATATTTCCTGTTTTGCCGCTGCTCATCGCCGGCTGCGAGGCCGACAACCGGGCTGACCGTGACTGG
GTCCGCCAGCGCTGGCATGCCCTATCCATCGGCAACAGCTCCGGCATCGTCGACCGCTGTCTCGAGCTCACCCTCGAGGT
CTGGCGCCGTCGCGATGGCGATGTCCATTGGCGTCCACGTCGTCGCCAGCATCGCCAGCATCGCCAGCAGGCCGGGTCCT
TCCCAGATTGGACCCAGAACCGGCTCGTTGACAACAGAAGTAGTAGCCCCCGGCCGGACGACAACGGCGACTTCGCCAAC
CCCTTTACTCTGCCGCCTTGGTCCGCTGCCGCTGCACCGTTCTCCGAATCCCTTCAGCCAGCGCAGCCACGGGAATCCGA
CTGCTCCCCCTTCCCCACGCCTGAATACACTGTTAAGAGCAGGCAGCACTGGCTAAGCGTCATGCGCGACTGGGGCTGGG
AAGGTAAGTCTGTCTGGCAGTCTGTCTCCCTCTCGGCTTGGACCGCGCGACTGACGTGGCTTAGTCATGCTAGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62