GenePrediction:GLEAN_2904 Details

Name: GLEAN_2904
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4104623..4106520 (+ strand)
Length: 1898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4104623..4105120 (+ strand)
Length: 498
Type: CDS
Source: GLEAN
Position: GCSC_140:4105185..4105922 (+ strand)
Length: 738
Type: CDS
Source: GLEAN
Position: GCSC_140:4106041..4106094 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:4106192..4106298 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_140:4106358..4106520 (+ strand)
Length: 163
>GLEAN_2904 class=GenePrediction position=GCSC_140:4104623..4106520 (+ strand)
ATGACAATGTTACAGCAGTGGCCCCTTTCCGTTTCGGAATCGGCCTTTATCGCCGTCATCATAGTAAGCAGTCTTTCTGT
CCATCTCTTCCATCGAACATGTGCATCTAACACGCAACAGCTTGGTCTTTACTATGTTATAGAAAATACTCTTCTCAGCC
CGCTGCGCTTCCCGGGACCTCTGTCAGCCAAGCTGTCCTCCTTCTGGATCGTGCTGCAGTGTCGCCGCGCTCGTCGAACG
GAGGCAGTGTTGGACCTACACCGAAAGCACGGCGACTTTGTTCGCATTGCCCCGAATCATGTGTCCATTGCCGACCCGAG
GGCACTGCGTGATATCTACGGCCACAACACCGGTTTCACCAAGGGTCCCTTTTACGAGGCCTTCCACCAGGTTGACCCAG
TCCTCTTCAACATGCGTGGTCTCGAGGCACACCAAAAACGACGAAAGCTGATTAACCCGGCCTTTTCACCGGCAAACTTG
AGGGCTTTTGAGCCAGAAGTTACTTCCAGCCTACTGAAACTGAAACAGACCCTGAAGAGCATCGCCCAGTCGGGACAGCC
AGTCGACTTTAGCTTATACGGTTAGTCTTGTTGATTTACTGTATTTATTCGATTGTGCAACTCTAATTGGACAAGCAAAC
TTTCTTGCCTTTGACGTCATTGGCGACTACGCCTTTGGCCGTACGTTTGGCTTCTTAGACCGCGGATACGACCACTTGAA
TTTGATCGAATCCATCGATTTGCGCGGCGAGGTAGTCAACGCGCTCGGCCACCTGCCACCGTGGTGCCAGCCGCTGATGA
AGTACAATGTCTTTGACGGCTTCTGGTACCGCGGCACCAAAGCGCTGGCTCATCTGGCCTCAATCGGCCGCGAGGCCTAC
TTTATGCGCAAGGCCGCCGTGTATGAGCAGCGCAAAGATCTGCTCAGCTTCCTGCTGAACTCCAAGACGGTCCAGATGAC
CGGCGTGCTGTCAGAAAGAACGATCATTGCAGAGTCTATCAGTTTCATTGTCGGTGGCAGCGATACAACCAGCAGCAGCA
TGACGCATTTTGTCGACTTTGTGTCGCGCGATCCCCGCCTGCAGCACCGCCTGCAGGAGGAGCTTGATGCAGCCTTCCCG
GCGGCCGAGGCCGACGCCAACGAGGATTGGGTTGCCGACTTTGGTGTTGCCGAAAAGCTACCTGTCCTTATGGCTACGAT
CCGAGAGACGATGCGGCTGCGGCCAACAAGCGCAACAGGTTTGGAACGGATCACACCAGCGGGTGGACGGACCATAGCCA
ACGTGGTCATTCCTGCCGGAGTAAGGCTAATGTTTGGAGCTTCTTTGTTATTATCCTTTTTCCTTTTCCTTTTATTTTCC
TCTTTTTTTTTTGTTATCCCTTCCCTCCTCCCTTTTTTACATTATGCTAATCTTTCAGACACTTGTCAGCGTGCCTACCA
GAAGCATCATGCAAGATGCTCGCATATTCAAGGTATGTGCAACCGTACCCGGGTCTTGACCGGTAGTTCGGGTGGCTACA
GAAGTGGACACTGATGGAACAGATTGCTGATCACTACCCACTTGGATAGGACCCGGCCGAGTTCAATGTAGACCGCTGGC
TGCAAGCAGACTCCGCGCAGCTGCTGGAGTATTTTAACCCCTTTTCGCTTGGGCCTCGTTCGTGCATTGGCAGAAAGTAA
GTGACGCGTGTATTGATTAATTTCGGGTTTGTTTGGCCCATGCTAATACGAACAGCTTCGCTTGGATGGAGGTCATCAAG
ACACTGGCCACACTTTTTCGTGTCTTTGAGTTTATCAGAACACGTAGCGGGCTTACCGAGCTACGCGAGGGCTTCTTTGT
AAAGGCAAAAGAGTGCACAGTGCGCATTTCGCGACGGGCAGCCACGACGGCTGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62