GenePrediction:GLEAN_2905 Details

Name: GLEAN_2905
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4115413..4120480 (+ strand)
Length: 5068
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4115413..4115457 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_140:4115526..4116398 (+ strand)
Length: 873
Type: CDS
Source: GLEAN
Position: GCSC_140:4117238..4117269 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_140:4117502..4117697 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_140:4117758..4118099 (+ strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_140:4118153..4118216 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_140:4118268..4120480 (+ strand)
Length: 2213
>GLEAN_2905 class=GenePrediction position=GCSC_140:4115413..4120480 (+ strand)
ATGGAGAAGATGTCTTCATTACATGAGAGTCCCGCATCGTGGCCGGTACGCAGAACTAAACTTCGTTTCATTCCAATGGC
TTGGCATTGTTAACATGATCTTGTGGCTGCCAGATCCCTGCCAGCGGGTTTGGCAAGTATGGCACGGCGGATATCCTGCC
GGCTTCCTACCACTACCGTACGCCGGACAGGAAACAAGAAGTTCTCGACCCGACTACCAACATACCAAAGTTCCTTCGCA
CGGCGTTGTCGCTTGGTGCACTGGAACCTATGCTGAAGCATCTTTGGTTCGCCGGGGCCAAGCACCCCCCCAAACAGCTG
CATTTCCAGGTTGCCATAGGACGGGAAATTGCTGTCGTGGATCGTATGGACTTGCACCTTTTTTGGGACAACAACGGGAG
ATTCTTCGTGAAGCCTTTGCCGAGATTCCTGCTCGATCCAGAGTTTTGCGAAGAACACCTGAAGTGCCCTGATAGGTGCG
ACTGCGGATCGTCACAACAAGACGAGGAAGAAGCAGGGTGTATGAAGACACCAAGAGAGATCGCTCTAGGCTTCCTTTAC
ACGTATGCCTGTCTCATCTCGTCCGAGACTGATTTCTTCCTCGCCCGGGAGAAGAATTTATTGCCGGATATCGATTGGGT
CCCATGGAAAAACGTGGTCAAGGATATTCTTCGAAACCACGATGACAGCCGAATACACCAGAGATTCCAGCGTGGCGAGC
TTCGCCTATCCCGCGTCAACACGCTTCATCGCTTCACGCGACTGTCACTGTTTGACCCGTACTTTCGCGGCTGGAGCAAC
TACAGCAGCCTCTTCTTGGACAACTTTGCTTGGATGGCCGGTGCAACAGTCTTTGTGGCTCTGGTGCTGACGGCCATGCA
AGTCGGCCTTGCGACGAAACGGCTCAATGGCAACGCCGCTTTTCAGCGGGCGTCCTACGGGTTTACCGTCTTTTCCATCT
TGGGGCCGTTGGGCGCGTTCTCGCTAGTGAGCCTCTGGGCGTTATTAAATCTTGTCAGAGATCTGCCATTTTTGTTTGCA
GAGAGAAAGAAGGTGGGGGGCAAGTTGTCTTCACGAGTATGAGAGTAGGTGGCGTGTGATCCGTGCTAGATGCCATATAC
ACGGTCTATTGGCACTGTGTAGTGTAGTCCAGCAGGACCCACCTACTCGTATAAATGAGACGGGTTACATCCGAGATCAT
CCGGAAGTTTTCCCACTCTGTAGATAGGATTGAGGCCAGCAAAGACAACTTGCACTTACATAGCAATACCTTCGATATGC
ACTCACCTGGTCTTTTCTTGGCCTTTATCTTTACATGGTGTAACAGGTCTGTGACGTTCGCCATCCGCCTTGATAGGCTT
GAGCCGGTCGAAGTCTGGGGATTACGTATGCAGAAGCCGCATTCCATTTTCTCGTATTTGAAAATAGAAAAATCGGTTAT
AGAGACCCGACATGATAACGGCTGCACAGTCTTCGACATTCCTATTGCGAACTGGACGCTATTGGCAATAAATCCCAGAA
GACGGTAACAATGGCCGTGCTATTGTCCTGTATGCGAAGTGCGATTATCGGTGCCGTCGACTTGGTAATAAGGCGACATA
TGCAAGGGCGGTTGGGACCAATGCACGACAACAACTTCCACGTGTTTCGGAGAGCTAAATTGGCCTTGATTATATAACGG
TGAGAATGGCGACAGTTCTGCTTGTCATGCAAGCTTCCGAGGCTATGACATGTTCTCCTGGCTTTGGGGTTTTGCTCCAC
AAGATCCGATTTAAGAAGCTGCCCCGATCAAACGTGTTTGACGTCGCAGTGCCTTTGCACACTAGTCCGAAAGGATGCAC
GAGGGCCTTGGCAGGAGGTCCGTGTTCTGACGAACTGCCCGTTCTGGAGTAGGATGAGCGAGCACGACTCGTATTTTTAT
CGTATGGCGTATAACAGCAAAGACCCACGAGACGAACGCATGGCTCCCCTGTTGTCGGTCCTGTTCACCACATATAAGTA
GGATTTGATGGACGGCCGTTCCGTCCGTGGAAATGGTCTTTTGCAGGGTCAACTCGTCCACATTGGGGAGCTTCCTGTTC
TACTGCCAGCACCAGCACGATGCTTCTTCTGCGCTCGCTCTTGGTTCTGTCCTCGGTGGCAGGCAGCCTGGCTGCTCGCC
GGGACCCGTTTGCTCGCCAGGATCCGGTTGCGCTGCACCGCCGAGCCGACGGCGGCGACGCGGACGCATCGTCCAAGAAC
ACGACGGACATCCAGCCGAAGCGGTTCATCGTCGAGTTCAACGGGGTATGTTCCACCTGTGCAGCTCTGCTTTTGCAAGT
GTCCATCTGCTGACTTGTTTTCAAGGGCTCCGACTCCCAGACGGAGGCTGATGGCCTCGCAAGCCGTCACAACCTCACGG
TGATCCGGGTCTTCAACAGCGACGTCTTCCAGGGCGCCTGTGTGGAGTCGGGCCGGGCCAACCTAGACACGCTCAAGGCC
GAGGCGCCGGTGACGCAGGCCTGGCACGCCAAGCGCATCGCGCTCAGCCCCGTGACGGTCAACCAGACGTTTGGCGAGGC
GGCAGCCGGCGTCAACATGTCGGTGCACCACATGACCGGCGTGGACAAGCTGCACGAGGCCGGCATCCGGGGCAAGGGCG
TGACGGTCGGCGTGGTCGACACGGGCGTGCTGTACACGCATCCTGCTGTGAGTGAGATGTCCTGGGCGGTGTTGGGGGCG
GTCCGCTAACATGCACGCAGCTGGGCGGAGGCTTCGGTCCTGGCTACAAGGTTGTGGGCGGATACGATCTGGTCGGCAAT
GGAGGTGAGAAATCCTGCGCGCGTTTTGCCCTGTAACACGCCTGACAAAGCGCAGACTGGCCGACGGACCCGGTCCGGCA
GCCCGACAACGATCCGATCGACGAGCTGGGCCATGGCACCCACGTTTCCGGCATCATTGCGGGCGAGAGCAAGCTGTTCA
CGGGCGTTGCCCCGGACGCGAAGCTGCGGATGTACAAGGTCTTCTCGACGGTCGACTCGACGAGCGAGGACGTGCTGATC
GAAGCCTTTCTGATGGCGTACAAGGATGGGGTGGACATCATCACGTCGTCCATCGGCAGCCTCGACGGCTGGGCCGACAA
CGCCTGGGCTCTGGTGGCCTCCCGGCTGGTCGACCAGGGCATCGTGGTGACGATCGCGGCCGGCAACGACGGCGACGCGG
GCGCGTTTGCGTCCAGCAGCGGCTCCTCGGGTGCCAACGTGCTGGCGGTGGCCTCGATCGACGCGGACATCTACCCGGGC
CCGTCGATGAACGCGACCTTCCACTACAACGGGACCGAGAACAACGTGAGCATCCCGTACCGGGCCACCGACCCCTGGTA
CCCGTCCAACATCACCGGCTGGCCGATCGTACCGCTGGGGCTCAACACAAGCATCGCCGACGAGGCCTGCCAGCCGCTCC
CGAGCAACAGCACCCGCGACTTTACCAACACTGTCGTGCTCGTCCGACGGGGCGGCTGCAACTTTGCCGTCAAGCAGACG
AACCTGGCCGCCTTCAACGGCACCACCATTCTGTTCTACTCTAACGAGCTGCCGCTGGACATTCCCACGACCAACTATCT
GGGCGACAGCCAGATCGCCATGATCACGCGCGATGCCGGTGCTGAGATCATCCGCACAGTCAAGGCCGGTGGCCAGGTCA
CTGTCGACTTCAGCAGCAACCCGATCTGGACGCTGACGGGCGTGCCCAACGAGGAGTCGGGCGGCGCGCCCAGCTTCTAC
ACCAGCCTCGGTGCCACCAACGACCTGTACGTCAAGCCGGATGTCGCTGCACCCGGCGGCTACATCCTGTCGTCATACCT
GAAGAACGGCTACGCTGTGCTGAGCGGCACGTCCATGGCCTGCCCCTATGTCGCTGGCGTGGCTGCGCTGTACATTGGAC
AGTTCGGTGGTCGCCAGACTCAAGGAACTGGCTTTGCCAAGACCCTGGCTGCCCGCATCATGAACTCCGGGCAGCCGGTC
CCTTGGAACGATGGAGTTGGCGATGTCATCAACTACGGCATCCCTGCGTCCGTCGCTCAGGTCGGCACCGGTCTTCTCAA
CGCCACCAAGGTCCTGCAGTATCACACCGACCTCTCGCTCTCTAAGTTTGCCCTCAACGACACCCACCACTTTAGCCGCT
ACCATACTGTCGAGATCACCAACAACGGCCCTCAGCCCGTCACCTATTCCTTCTCGTCTACCGAGTTCGGCGGCCTCAAC
ACCTTCAACACCGAGGCCGATACCTGGGACACGCCGCGCGTCGCCTACAGCGAAGAGGTCATGGCTGAGCCCGTTCGTGG
TGCTGTGCCTGCTATCTCTTTCCCTGCTAGCCCCTTCACCGTGCAGCCTGGCGAGACTCGCACGGCCGAGATAGACTTTG
CTCCCCTCGACAACGCCGCTCTCGGACTCAACGCCAGCCAGCTGCCCCTCTACAGCGGTACCATCAACATCGATGGCTCC
AACGGCGAGTCCCTCGCTGTGCCTTACATGGGCCTTGCTGCCAACCTGCACAAGGATGTCGGCACTATGTTTGATTACGT
AATCGGATTCCCCACACTGTCCTCCACGGCCAAGCACATCCCCATTGCCCAGAAGGCCAACGTCACCTTTGACCTCGATT
CCGACGTCCAGGACTACCTCACCTTCTACACTCGCTTCCGCTACGCCTCGCGCGAGCTCCGCTGGGACCTCTTCAATGCC
AATTGGACCGAGCGCGACTGGGTCTACCCTCCCGTCGTCGGCCAGAACGGCTACATTGGTGCGGCCACCAGTTGGACCGA
TGCCACTGCTGGCTCCTACTTCAACGCCACCGAGGATGACCCGACAGACGTCGTCACCCTTCCGCTCATGAACCTGCCCC
GCAGCATCGTCGGCTCCTATGGCGTCGAGCTGTGGTGGCTTGGTCGCCTCGCAAACGGCTCGCAGATTGCTCCCGGCAAG
TACAACATGCGCATTGCTGCGCTGTCGCCCTTTGGCAACCAGACCCATTCCGACAACTGGGACGTGTACAAGACGCCGAC
GATTGAGGTCTTGCCGCTGGAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62