GenePrediction:GLEAN_2906 Details

Name: GLEAN_2906
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4128451..4129488 (+ strand)
Length: 1038
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4128451..4128742 (+ strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_140:4128828..4128953 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_140:4129010..4129488 (+ strand)
Length: 479
>GLEAN_2906 class=GenePrediction position=GCSC_140:4128451..4129488 (+ strand)
ATGTCTGTCCATTTCCACCACGACCTGGACCCCTCTTCGGCCGAGCCATTTCTGGTCGCCACAAGTAAGGCCCGCGACGA
TGACATTGGTTTCGAGGAAGCCGATCTAGGCGCCTCACGCCCTCTTTACAGAGGCATCGTCGTGCAGGACGTTTGCATCC
GCATCATCTACTCGCCTTGGCTGCCATGGTTTCTTCTTGTCCTTGCCGGTGCCGCTCTGCTCCATCAGACCATTTGTCCG
TGGACAGCCGAGCAGGCTGAGACACATCCGGGGCCTCCCCACCTGCTCTACAGTATGGTCCACCGTCCGATCTCCTACCA
TCAGCTCCACCGAGCAGCCCGACTGCTCGTCATGCTGACACTCTGCCCTCGTTTTAGGCCCTGCACAGGACGCGGTCGAG
TACGAGGTGCACAAGTTCCACCTCGGTCTCGACACCGACCTAACCGAGTACCAGGGTGAGCCCTCGCCTGAGCTGGACCG
AAGATGGTCTGAACTCTACAATGGTGAGAACAGATGCTCCATAATTCCCTGTGCGCCTTCGTATTCGCTGACGGTGCAGT
CGGCATCAACCTCATCCCGCTAGAGAGCGCACGGCAGCTACCCAATCGAACCATCCTCTTCCCGCACGACGAGCAGCGTC
GCTACCTGGTTGAGCTCGACGTGTTCCACCAGCTCCACTGTCTCAACATGATCCGCAAGGCCCTACGCCCGGACTACTAC
AAGCCGCATCTACCCGGTCCACAGCCTGGCGACGAGGACGAGCTGCTGGGCCCACAACACATTGATCATTGCGTCGACGC
GCTGCGCCAGTCGCTCATGTGCAACGCCGACATCAGCGTACTCGTCTGGGGCTGGCACCAAGGCCGCCAGCGGCACACGG
AGCGAGGCACCATTCTCCACACGTGCAAGCGTTTCGACAAGATTCATGAGTGGGCACGACAGCACGCCGTGTACGAGGCC
ATGGACAATGGGTTCCGCGAGATGAACGATCCGCTGGATCCATCGACTTGGGAAGGTGGATATCACGGGGAAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62