GenePrediction:GLEAN_2908 Details

Name: GLEAN_2908
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4131864..4133304 (+ strand)
Length: 1441
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4131864..4131932 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_140:4131983..4132639 (+ strand)
Length: 657
Type: CDS
Source: GLEAN
Position: GCSC_140:4132706..4132775 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_140:4132832..4133304 (+ strand)
Length: 473
>GLEAN_2908 class=GenePrediction position=GCSC_140:4131864..4133304 (+ strand)
ATGAACCACGACGATTATGACTCTCGTCTCGACCTTGTCCATGGAGTATTGGGCAAGCACGGATTAAAGGTCAATTCCCA
GGATTTCTGCAGCAGCCAGCAGTGACTAATGTCTCTCAGGCAGCCTCGGTCGATCCGCTCGACTACGACCCCGACTGTCC
GTTCCCCTTCAATAACTTTCTGTACAGGGTGCAGCTGGCCTCGCCCGCGAACACGAAACACTTTACCGGCCTCGACCAGC
CGTGCACCACGGCCGCGCCGGCCGAGGGTCTCTCCACGGTCGTCGTCCGGCTGAGCAACCCGCGTGCTGGCGGCCTGCAG
CAGGCCAACCGCGTCCAGAATGAGGTGGCTGCCCTGTACTTGGCGCAGGCTGGCATGAAAGCAGTGCGTCCATCTGCCGT
CTCGGTCATCCCCAGCGTCTATGCCTGGCAGCCGCGCACGGCCGAGACCGAGGCCAAGGCCGTCTATGGCTGGCTCATCA
TGGAGTACAAGACAGGCACGCCGCTCGACAAGCTATTTGACGACCTGTCGCCCAAAGCCAAGGACTCGGTGCGCCTGCAG
GTCGCACAGATCGTCGCTGGCCTGCAGAGCGCGCCCCTCTCGGACGAAGCACCGCTCCTCGGCAGCGGCTACATTGGCGG
GCTCACCATCACGGACAGCGGTGGACACATCGCGCCCGGTTGCATGACGACGCTCAAAGGCGGGCCGTGGAGGAGCTATG
CTGACTTTGTGCAGACCCGGCTGGCCGATCAGCAGACCGAGGGCGGCGACAGCAGCGTCATCCAGGGCTGAGAGCCCAAC
GGCGTCCGGACGCGGCTGGAATAACTCGTGGCCGACTCGCAGAAAATCAAAGACATATTCCCCGTCAGCGGTGTCGAAGC
TACACGTCGTGTGCTGGTCCATGGTGATCTTAGTAAGCTTGTCTCTTGACTTGGCGCAATTTGTCAGAATGCTGACTAAT
CCATCCAGCCATGAACAACATGCTTTACGACAAGGAAAGTGGCAAGATCACGGGCGTTGTCGACTTTGACTTTGCCTTTA
TCGGCCCTCCCGTCTATGAATATCTCATATCGCTGCAAGACATTGGGGGCAACTTGCCGAGTTTGATGCAAGAGTTGGAA
GGGCATGAATCAGTCGTGAACACGTATCTGAGCAGCACTGCAACACCAGCAGACGAAGCGGACCTTTTGAGCGAGCAGCA
AGTGGCGCTTCAATCGACAGTGTCCTTCTTTGGGGCATTGGCAGATGCAAAGGCCTTGCCGCCGACGGACATCTGGGGCA
TCGTTACATGGCTGAACCTCTATCGGTTAGAGACGCTCCTCTGTCCGATGCGACTAGTGCACCCGCATTTCCTCAAAAAG
AAGACAGAGGACGAGATCGCGGAGGCACGGAAACTGACTGAGTCCAAGATTCTCGCATGTCTCCAAGGTCTGGGAACATG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62