GenePrediction:GLEAN_290 Details

Name: GLEAN_290
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:799771..801710 (+ strand)
Length: 1940
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:799771..799822 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_167:799997..800762 (+ strand)
Length: 766
Type: CDS
Source: GLEAN
Position: GCSC_167:800834..801605 (+ strand)
Length: 772
Type: CDS
Source: GLEAN
Position: GCSC_167:801660..801710 (+ strand)
Length: 51
>GLEAN_290 class=GenePrediction position=GCSC_167:799771..801710 (+ strand)
ATGGGGAACAACGCCTCCTCCCCAAAGGCATCAGGCTCCGCAGGGCAGGGAAGTTCTGCTGGAGGGAGCGTTAGTGGCGG
TGGTAGTATCAGCACGGCTCGCGCGACACATTACCATCAGCAGCTTCAGCAGCAGCAACAGCAGCAGCAGCAAAACCTGA
AGAAGCAGCAGCAACAGCAGCAACAGCAACAGCAGCAACAGGCGCAGCAGCAACAGCAACAGAAAGGCGCAAGGAATCCG
GTCCTGGTGCAAAACCAGCGCGTTGCAGCCGCACCGCCCGAGCAGTCGATGGCCCATGCTCAAGGCTTGACGGCAGCGCG
ACCGACGTCGATGCCGCCGCGATCGTACGGCTCTGCCGCCGAGGCTGCGGTGTTGGCCGCGTCATCAGCGTCGCCCGCCC
GCTCCTCTGTTGGCACCGCCGCCAAGCCGACCGACATCAAACCCCGGCCGATCGAGGTGCGCGGCACGGCGCCCTCCTCA
ACCACGCGACCTGTCGACGTCCCCCACAGCAACGTGCTGCCTCCGACAGCCGGAGCGGCGGCGGCTGCAGCAGCCGTGGC
AGTGCCAGCTTCGATGGCCCGAGTGGGAATGAATACATTCGACTCCGACCCTCCCCTCAGTCCTTATACCGACAGCATGG
ACATGTCAATGCTGCACCACAACAGCATGCAGGACATGTCGTATCTGACGCGGCCGCCACGACTACCGCTGCCGATCGAA
GAAGAGGTACACACGCCCGGATCGCCGATCATTGCGCCGCGCAAAGCCGACAGCCTGCTGGAGGAGATCGAGGCGCTTGA
CAACGACGGGCTGACACATCGATCGTCGACGGTCAGCTCGACCACGGTCGACGAGGAGGACATGGAGGAGCTGCGGGTGG
ACAAGACACGACCCACCGTGCCGACTCGGCTGGAGTGGCTGCGGGGCGGCGAGAAGATTTATGTTACTGGCACGATCTTC
CAGTGGAACAAGAAGCAGCGGCTGCACCCAGTGTGAGTGTGCCCCCCTCTGGCTTGGGGAAACATCTGTTTTATCTGGTC
AAGGCTAATCACGACTCTGGCAGCGAGGGACGACCAGGCACGTTTGCGACGACGATCAACGTGCTGCCCGGCACGTATCA
CATCCGGTTTCTCGTGGACGGACAGGCCGAGACGTCACGTGACATGCCGACGACTGTCGACTTTGGGAACAACCTGGTCA
ACTATATCGAGGTGGCGCCACAGAGCACGCCGCCCAAGGAGAGCGACGCCGCAGCCGCAGCGGCCGAAATGAGAAAGCCG
AAGCCGAACCAGCAACAATCACAGGGCCAGCCGCAGCCGCAGCAGTCGTCACAACTGCCATCGTCACAGCAGCATCAACA
ACGAAAGGCATCGCAGTTGTCGCAGCTGTCGTCGCAGCAGCCGTCGCAGCAGACGAAGCAGCAGCAGCAGCAACAAATGC
AGCAGTCGCAGCAGTCGCAGCCGCAGCCGCTCTCGACAGGGGAGCTCAAGGCGGCGACGCCGTCGTCGGCCGAGCTGACG
ACCAAGCTGCCCCGGTGGAAGAACGTGCCACCGCCGTCGGCGTTCTCGCACGAGCTGCCGCAGTACCTGGTGGACTACGA
CCAGCCAGATGACTCGCCAGCGTTTGTGTCGGCGTCGGCGGCGACGGAGATTCTGCCGCCGCCGCCGAGTCTGCCGGGAT
TTCTGGGCAAGCCGATCCTGAATGCATCGACGCTCATCAAGGACGACAACAGCGTGCTCAACATGCCGAACCACTCGGTG
CTGAACCATCTGGCGACGAGCAGCATCAAGAATAACATTCTGGCCGTGTCAGCCACGACACGATACAAGGACAAGGTTGG
TTCCTCCCCACTGTCTCAATACCTCTCCATGCCGCTAACACCTACGCAGTTTGTCACAAACATCATCTACAAGCCTACCG
GCTTGGATGACAAGCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62