GenePrediction:GLEAN_2911 Details

Name: GLEAN_2911
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4139827..4149737 (+ strand)
Length: 9911
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4139827..4140158 (+ strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_140:4140227..4141717 (+ strand)
Length: 1491
Type: CDS
Source: GLEAN
Position: GCSC_140:4142288..4149737 (+ strand)
Length: 7450
>GLEAN_2911 class=GenePrediction position=GCSC_140:4139827..4149737 (+ strand)
ATGGAGGACCTGGAGAGAGTCTTCAACCATGTTGTCCTGCCTCCCAAGCTCCCAGAGGAGCACGATCCTGACATACCCTT
CCTGGAACACGCTTTGCTCCAGCGTTTGATGGATGCCGCCAAAATGCTTCACGAAACCACGAACCATAGCTTCGATGGCG
GTTGGACTGTTCTCCGAAGCTGTCTTCAGTCTACTCGCATCCTGAACAGCGAGACGCTCGACAGACTGACTTTAAAAGTC
TCATTCCAGGCTTTGCTTCAAGAACACAACCGTGTCTTGGTCTGTCATGTCGTCGAACAGAATGCAGCCCTTCTTTTGCA
TCGCCGTACAGAGTACGCAGTTCCTTATCCCTCTTTCGCACACCACACGTCACCTGGTGGTTTCTTTGCTGACGGTACAG
TGCCAACAACAATGACCTTGTCGTGTTTGAGGCCTTTGAAGCATCGCCGCAGTCGCAGGACGTCCTGGCTGCTCCCAATG
CCCTCCGTTGGGAGTTTCCTTCGCGTGCAGCACAGATCCCGATTGCCGACTTTGAGAACGAAGGCTTCCAATCTGCACTT
GCATCTTTCCTCGACAAGGCTAGTTCCGAACAGCTTTCTCATCTTGCCGCCAAGGCCTCGAAAGATGGCGTCTCTTTCAG
CGAGATTCGAAATCCGGGAAGCCCGGCGCTGATCACACATATGCTCATCACTGTCATCGAAGCCATGGGAAGCGTATCCG
ACGTCGAACACCTGAACAAACGCGTCCGTGATGATGTCCATCTCAAAAAGGGAAACATTCCCTGGCGCCGCCTCCCGTTT
TGGCTCGTACTTCGTGTTGCTGCGCAACGCCAACTTCATCTTGCATTTGGTCCTATCACTGGACAAGCCGCTTACAAAAC
TCTTCTCAGTGCGCTTCTGGCGAAGTTGCTGGACGACTATGTTGAGAATAGCATGGATCCCAGCCAGATAATTCTGTTGA
AGAAAAAGCTGTGCCGGAGACTGGCCAAGCTTCAACGCCCAAGTACACAAAGATTCGAAGGTGTTCATCAGCTTCTCAAG
GACACCGAAGCAATGTTTCAAAGCTCCATCGAGAACGCAGATAGACACGTCAATGCTGTTTTTGCCTATTTCAAGGCATC
CGCCATCCGGAAGATCCCCCTCTTGCCTGCACGTATTAAAGATGGGGCTAGCGAGCTTCGCTTGTCTTTGCCCAGCAGCC
AGGCGTATCTCAGACTACTGCAGTCGTCACACCGAGCGGCAACTTGGGCTGCACCGCAGTACACTGTCAAAACCGGCGTT
CGCCGCTCGCTTATGGACCAGAGTGATGACAGCGGCATACTCAAGATGCAGCGGTTTGGCCAGAAATACCGATCCGTCGA
GACGGCTATGGACTTGGCCGGACGCCGTGCAGCCCAGTTCTGGACAAACCAATCTCTGACCGAAGAATACACCCAGAACA
CTGCCACCAAAGAGTGTCTCGCATTATCGGCAGTCCTCGAATCCTTGATGAGTGACATTTCTACGTTGAACGACACCAAC
CCAGAGCACTGTAGTGCCTTTCTTCTGAGCATTTTCGACTTGTGGGCAGCGATGGATGCAGCTGCTGCTCTCGCCTGCCC
AATGTTGCTAGACTATTCTCCTGCTTTCCGAGCAGAACTCCTCGACGTGCTTCAGTTGCCAAGCCTCAAAGATATGCAAC
GCCTTCGTCGTATCCAGGTATACCTACGCGATCGACAGGAAATGAGCAAGCATCAAGATACGACCATTTTTGGGCTGCTC
GGTGACCGCTGCTTTGGTGCAGACTTTACGGAAAGATCCATGGAACTGCGCGTCTTACGTGAGCGCATCAATGATCTGGA
GTGGAGGAACCGTGAACAAAAGAAAAAGGACTGGGAGCAGGAGTGTGAAGAGTATGACAAATTGTCGGCAAAAATACTTT
CCAACACATGCCGCTGCACCATTTTTCCCGACGGTCGCCGCGATGTTCGGGGTTGCACGCGCTGCTATTTCTGGAGGTTA
CGGAAGCGGATGACCATGACTGTATGCGAGGACCTCCTTCCTAACAATCAGTTCCGTGCTGCTGCGGTCGTCTTTGAACT
GGCTATGCCCCGGGTCATTGCCACATACCGAAACACAACGTGGAAAGTCTTGACGAAATTCGCACATCCAACAAAACCCA
ATGCCACTGGAAAAGTCTGGAGCCTCCGCGAACACGAAGAGCTTTGGAAATTTTCGACTCCCTCCAGCTCCCAATCGACA
ATCACGCTTGCCTCCCTGGTGAAGTCTGTCAGCCAGACGCACTACCATAAGCAGCCAATGAAAGTGGACATACACAAGCT
TCTTCTACCTCTGGCATCCAGATTTGATCTTTACGACAGCGAGTCGAATACTTGGGTCAGCCAGTACTCCAAACCCTTGA
CCTTGGCTCATTGGTGTGGAGTATATATCCCAGGAGATCTTGCCACTACTGTTCTTCCAAGGTTGTCGCACCCGCCGACC
CAACCAGATGGTCCATCGTCGTACACAGCTGTTTCGAACCGCCCCAAGTGCCCAACTGGAATGTCAGTTCACGAGTTTGA
GGCCTACCAGCGCCTGCTGTCTGGAAGAGAGCGTCGGTGGCTGACCATGCTGGTCGAACTGGGATCCTCCAATTTGAACT
TCAGTAAAGTGGACACAATGCTGCTCATGTCCCATTTGGCGAACCAGGCGGGACCCATGATGAGCGTGTCTTGTGCAGAG
GACACGAGTCATGATACCGCTCTAGGCGTATGCCATGCGGTGTTTTCTGACATGAGCTTTGTGCAAAGACTCACAGAAGA
AATTGGCAAGCGGCTGAGCATAATTCGAGGCAACTGGCATGAAATCAACATGATGGAGCTTCTGATAACGTTGAGTTCGC
GCTTATACTCTCTGGTACGGAATACTGCAGAACGACAAAAGGTTCTGAATCTCATTGAACTAGCTCGAGAGACGACCCTG
GGCTGGATTCATATACTGCAAAATGAAGTCGCTCATGCCAATGAGGGCAGTGTTGCTCAGCAAGCTTCCATGTACGCATT
CAAGGCAGCATTACTTTGCCGTCGCACAATGGTCATTTTCAGCGAAGGCGGCACGAAGTCTTTGTCTCCATCGGACATTT
CCAGCTACATCCGAGCCTCCGTGGCCTTGCAGCAGAATTTTGTCGTGGATCTCGAAACTTTGAGCGAGGTTGACAAAGCA
ATGCTGCAGCGTGACTTTTCCATGGCCACCCTCTTGCAGGACAAGATACGCACTGCGATCAGCTCCAATCCGGACATCGT
GACCATGGCAATAGCACATGGTGTTGGAATGATGGGCGAACACGAGACCGTCACAGTTGGAACTGAAGGAACGACTGCCG
ACCTGAAATACACGTGTTGGGAGTTTCTCCCGAGTCCAAATGGGGGATGGATATCTTCAGAATTGTCCAGAGGCCCGGCC
AGCAGATTTCAACGCATAGACTTCCACTACATCGAAGGCCATATTTTGGTGGACGGAAAGACTATTGCGAAACTGCCACA
AGAAATTCGTGACTCGGAAGATGTCAAAGAGCTGTTCGAAAATCAACATCTGCTCACCCTTCCTTCGAGTCTCCCCGGCA
TGACTCACCGCCTGACAAGAGACTATAAGGGGCACTATGTTCACTTCGGGATGAGAAACAAACGTGTGGTCATATTGACG
AATAGCAAGCATGGAGAGTGGGAATTTGTGCCGCGGCGCATCTTCATTGACGAAGGGAACACTTACGACTTGCCGCGGAG
TCTGGTCGACAACTGTGTGCACTGGTACAACATACAGAACAGAACAGTCGACTTTCGTCGCAAAAGCGACATCTGGTTTA
CGAGGAAACAATTTTGGTTTCTTGACATCACCAATCAGCAAATGTACAAACCTAACAATAGCACTCTTGTGGATCCGCAC
TCGCAGCTTTGCAAGAGGATTGCCTCCATTTTCAACGGTTTCGCAGATCCCCAACGTCTCACAGTGCTCCAGCCACGGAA
GAGCCCACTCTCAGTAGAGTTGCGCCACCTTGATCTATCATTCTTCGTCAACGGTAGCGGCATGTTGCATTGCAAGGAGC
TTTCCTCGGAGATCGACCCCAATCAGGATGCAGGAACTCTGTACGGCTATGAGAGCATGATTGTACTGCGGGATGTGTAT
GACCACAGGCGAAGAAGTCTGATCTTGCCGCTGGGAAGCTTGCGTTGGAAGCGCACAGGACCGCATGTTTCCGTTCAAAC
GGACATTGGCGAGCTACCGCGCGGCAGAGGCGTTGGTCCAAGAGCTCCGCATTCTGCGGACAGCACTTACGCACGCTTTG
GTATTGACACCATCCTTGGCCGTCTGACATGTCCCCCGGAACTACTCCTGCTTTACACGAAAGCGCGGCTCCATGCGGTC
ACGTCTTTTCCGTTGGCTGATCCCCTGACAGGCCGGACAGGTGATGAAGAGGCAGTGCAGACGCTCACATCGGGTCGCTG
CCAACCGTGGGTGCCTCTGGGCTATGGTCCGGCCGATATACTGCAACAAATCAAGATTCTGTCGCCCAAGCGTCTATTCT
ACCCGAAAAACATGCGGATACTGCAGCAAGTCAGCTGGGACGCCAACTTGCCGACACACGTGCAACACGATCACTATGGG
CGGCTCGTTCAGGAACTGTTTTCTAAATCAAAGAATCTCAGTCATTTCAACGAGAGTGCGGCTATGGCTAGCAATGGCGA
CGATGAATCTAATGAGTCCACCGACAAGACAGGTGTTGAAGACGACCACTCGAGCGCGTTGGGGATGCGGAGTGAAATCC
AGCGTCTGCGCTACGAGAGCCCACAGACAGGAGATTTGGTTTCTTTGGACACGGAAAACAATGACAGGCAGTACAACTCT
CTTGGGCGCATGTCAGGACCTTTTCCCAACGCAGAGAAAAAGGATGCTTTCAACACCTCATCGGTCTTTCAGATCACCAA
ACTGCTGCGCGAGGAGGCACGCGAAATTCCCATGGCACGGCTTATGTCTAAACTCATGAGCAGCTGGACTCTGATGGGCG
GGTTCGACACGGCGCTGGAGACTGACTTGGTGACTCTCAGCACGTTGATGAGCACCCTGACGATGAGCGAGCGCTGGGGT
CCTCTCGTGGAGCTGTGTCGCCGTGCAACATGGTCCAATGCGGCCGAGATCATGTTCACACTTGCCATCATTGCTTTCTC
GCCAGGCATAGACATGGATTACGTGCATCTTCTGGCAGCATACTCCTACTTGCCTAGACTCAAAGTTCTCACGCCACCCC
AGCATGCGTCATACGACCGGTTTCGCTTCGAGGAGAAGCCGACGGCCGAGACACTGAAGGTCCTCATTTCTTCGGCTTAC
CGTGAGTATCAAACGAACAAGGGGGGTTCAGTGGGATGGAGCTCCGCACTCGCCGAATACAGGAAGAAGTGTGCAGATTA
TCAGGCCGAATGCGAAAAGGAAGGAACCGAATTGGCACACAAACTTTTGCAGCAATGGCCAATATACAGTGAGCCGTCGG
CTATGGGGTTCTCGTCCAAGAAGATCGACGTGGCCCTGGCCCTGTCCACGATCACACCGGAATGGAAGCGTCTTATTCAG
AACAAGGATCTTACGGACTACGTGAGAAATATCCAGATGGCACTGATGCCGCACAGGACAATCCGAAAAGAGGGTCTGCG
ACTGAGAAACGTCACGGAATCTGCTGTCACTTGTGGAGGTCTTGTTCCAGCTCGCCTCACCGTTGTGCCATCACTTTATC
AACATCTCCTGCAAAGGAATATGCCACCACAGCAAGAGCAATACCCGGCAATGGGAGCAAATCCGCTTACAATCCTGGCA
CGCAGATCTGAGTTTGCTCCTATGCCTGTGAGCTCTCTCCAATCGGAATTGGTGGAACTGGGGCGAATCGTGTCTTCCTT
TACGAGATGCCCATCTTTACTGCGAAAAGACTATGCGAGAGATCTGAGTGAGAGCATAGGAGCCCTGGCGCGTGTCGCTG
GAAAGGATGCGGAGGGGGGCGCATCGTCGAATGAGATTCTTCCAGGAGAAGCCGAAATCGACAGCTACATTCAGTATGCA
ACCGCCTGGTGCGACGCAGTCTTGAGACACATTCGTGGCCACCTTTCAAGCGGTGGCAAAGCGTCCGGCTTACTCCAAAA
GGCCGACCTGTGGCCGCGGCTGACACCGGTGTCGATCCTCGAGCTTCTTCGGTCGACCTCCGAGTGTCGGTATGGAGACA
ACGTCCGGGAAACGCTGGTCACGTATGGATGTGCTGTGGCAGCGTTGCAACGGCTTCATCGCGTTCGCCGGATATTCAAG
AAGCACGATCTCCAGAGGGCTACCGAGGAGTGGCGGAACCGTGGCCACCTAAATTGGAGCCCGGCAGAGCAGACAGACTG
GCTTCTTTTCGAGATCGACAGCGATCTGCTGATTCGGACTGAGCAGGTGGAGGTTGCGCGGGCCATTATCGCGCCGGCTT
CGGGGAAAAACTCGGTGTTGCAGCTCAACATGGGCAAGGGCAAGACGTCGTGCATTGTCCCGATGGCCATTGCATCTCTT
GCCAACGGGAAGCAGCTGGCTCGTCTGGTGGTGCCCAAGGCTCTTCTGCTGCCCACCGCGCAGATGCTGCAGGCACGGCT
CGGCGGCCTTGTCGGGCGAGAGCTCCGCCACGTTCCGTTCTCACGGCGCATTGCAGCAGGCGCAAATGTCCAATCCGTGC
TGGAGATCTTCCAAGAACACCACAACGACCTCATGCGCCGCCGAGGTGTCCTCTTGGCGGCACCAGAGCACATATTGGCC
TTCAAGCTCAGCGGGCTGCAGTGCCTGGCAGATGGAAAGAACGCGATTGCGCGAGACATGATCGACTTTCAGCAGAAGCT
CGCTGACGAGATGTGCCGCGACATTCTGGACGAGTCGGACTTCACGCTGGCTGTGCGCACGCAGCTCGTGTACCCCAGCG
GATCGTTGTCGGCGGTCGATGCTGCACCACATCGCTGGAAGATGGCCCAGATGCTGCTGGCTATTGTCGAGGACAATCTC
CCCAGACTATGCCAACAGTTTGGCAACAGCATCCGGGTTCTGCAGCGGCCGTTTGGCGGATTCCCGATGATTTACATTTT
ACGGACGGACATTGGGGAAGAGCTGTACCGGTGCATTGTGCATGATATCAGCAGTGGCCGCGTGTCCTTCTTCCGTCCGA
CACCCAGCAGCAGCAGGACGAGAAGGGGAAGTCGACAGCAGATGCCTGTAGCGCCAAAAGAAGTCGCACGCCTCCTCCGG
CAAGCTCTCAGTCGCGACGCAGACGACAAGGACATCAACAAGGCAGCAGCGATGTTTGCAGATGTGCGTTCAGCAGCCGA
CGGGCTCACTCTGATCCGAGGCCTGCTGCTGAACAACATTCTTCTGACCTGCCTCGCGAAGCGTTGGAACGTGCAGTACG
GGCTGCATCCACATCGCTGGCCCATTGCCGTGCCGTTTGAGGCCAAGGGCGTACCGTCGGAGCGATCGGAATTCGGGCAT
CCCGACGTGGCGATTCTGCTGACATGTCTGGCCTTTTATTACATTGGCCTGAACCGGAGCCAATTCTGTGAAGGGCTGAA
ACACGTGCTGCAACATACAGACGACCCTGCCTCGGAGTACGAGCGATGGACGGCTGGGGCCGTGGGCCTGCCAAGCGAGC
TGCAGCACTGGAACATGATCAACGTGGACGACTCGGCACAGGTGCAGAAGCTGGGAGGATACCTGCGTTGGACGCGGCCA
GTAATCGACCACTACCTCAACACGTTTGTGTTTCCTCTGCACTCTCGGCAGTTCTCGGTCAAGTTGCAGGGATCTGCCTG
GGACCTCCCACTCTTCCGGGCCGGGACGGCAACGACGGGCTTCAGCGGGACCAACGACAACAAGATGATGCTTCCGCTGA
CGATCAAGCAGGAGGATCTCCCCAGCCTGCGGCAGACCAACGCGGAGGTGCTCACGTACCTCTTGAAGCCGCGCAACCGC
AACTACAGGTGCATGGGTACGGGGACGCAGCGCTGGAGGGAAGAGGATCTCCTGGCCAGCCTAGTCAAGGAGAGGATTCA
TGTGCTCATTGACGCCGGGGCGTACATCTTGGAGAAGGACAACGAGTCTCTCGCACGAGAGTGGCTGGACAAGGATATCC
ACCGGAATCGACAGAGGTACGAAGACGACGACTACAATGCGGCCGTGTTCTTCAGCGCAGACAACCGGGCATGGGTCCTG
TCTCGAGATGCCACAGCCGAGAAGATGCCGCTGTTGGCATCGCCGTTTGTAGACCAGCTGGACAAGTGTCTCGTGTACTT
TGATGAAGCCCACACGCGCGGGGTCGATCTGTTGCTGCCACCGAAGAGTCGGGGAGCACTGACGCTGGCTCTGGGGCAGA
CCAAGGACCACACGGTGCAAGCAGCAATGCGGCTACGGCAGCTGGGGACGACGCAGTCGGTGATATTTTACGCGCCACCA
GAGGTGGACGAGAGCATCCGCGAAGTGAGCCGAAGCCGGCTGGAGGGTCCAATGCGAGCAGCGGGATCCCGGGGACGGAT
AGAGTCTCCTCATGTTATCTGCTGGCTCTTGGAACAGACGTGTCTGGCCAACGAGCAGCTGCACCCGTTGTATCTGTCGC
ACGGTTATGACTTTTGCCGCCGAGCCAGCGCGCAGTGGAAGTATGGATCGAAGCTGGCCGAGGACAGGTCGCGGGCAGCC
CTTCTGGACGTGCTGCAGCAGCCAGAGCGACAGACGGTGGCGCAACTGTACGGGAACAGCCCAGAGGTGAGCTGGACGAC
CAAAGCTGCGAAGACGGCACAGAAACTGGCGTTGCCCGAACTGGAGGCGTTTTCGATGACGCTGCAGTTGCAGCAACGAC
AGGACGGCGCGGTGTTGGGCGTGAGCGGTGGAGCATGGCGGACGCAAGCGCAGACGACAGGGGCGTTTGAAGAAGTCGAG
CAGGAGCGCGAGGTCGAGGCACAAGTCGAACAGGTGCGAGCACAGCAGCGACGGGTACAGTTCGAGGCGCTGGTGTTCCC
GGGCCAAGTGCACCGCAACATCCGGGCGTTTGTGCGAACGGGCATTCTGGGCGGCGACCGAGGCTACAAGCCGGCCTTTG
CGAGCATGGCGCAGACGGAACTGGGCAGCCGCTACGGAGTGCAGGCGCTTTGGCCGACGCGGCTGTTTGTGTCGGACGAG
TTTGACCGGACGATCGTGGAGGAGGGCGGACGAGGAGGCGACGACTTTCTGCGGCCGGTCGAGTGGACGATCTGGAGCCC
GACGACGGAGACGGCGTTGGTGGTGGTGCCGGAGGAGCTGGAGCTGCTGCTGCCGCGAATTCGCAGCCGCGAGTCCAGGG
TGCATCTGCTGGCGTATGCAGCGCCCATCACACGGCCAATGGCGACGACGTTTAGCGGGCTGCAGTACCTTGCGCTACCG
GCGCTGCCAGCGGGCAGTCGGCTGCCGGCCTGGCTGCCGGTCGAGCTGGGCATCTTGGCTGGTCGGCTGTACATGACGCT
GGACGAGGCCGTCGCAATGGCAGAGTATCTGGGGGGCTCGATGATGGAGGATGTAGCTGCTGCTGCAGACGCCAGGACGG
ATGCCAAGGAGACCCCGTCGCTCTTCTGTCCGGATCCGGCCAGCTTCCTGCTCGAGTGGCTGTCGTTGCGACGCGTCGGT
CAGGACATTATGCACACACCGGCAGCGTATATCTGCCAGGGACGCGTCATCCGGCCAGACCACGCCTTCTTTGCGGGCGC
CGGGGACGGTGGCCGCGGCAGTCGGCTGTCAACGTCGTCAGGCGAGTCTGGACGGACGAGCAGCCCGGATGTGGCGCTGT
TTAGCGAAGGCGGAGAGGTGGAGAGCGACAGCAGCGAGAGCGGAGAGAGCGGAGAGAGAGAAAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62