GenePrediction:GLEAN_2915 Details

Name: GLEAN_2915
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4161564..4166937 (+ strand)
Length: 5374
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4161564..4163018 (+ strand)
Length: 1455
Type: CDS
Source: GLEAN
Position: GCSC_140:4163089..4166580 (+ strand)
Length: 3492
Type: CDS
Source: GLEAN
Position: GCSC_140:4166635..4166937 (+ strand)
Length: 303
>GLEAN_2915 class=GenePrediction position=GCSC_140:4161564..4166937 (+ strand)
ATGCCTCCTCCTACTTCATCCACACCAGACCCATCGTCTCGCGCCGCTCTCTCTCCCGCCTCGCCCGCCTCGCCTGCCTC
GCCTGCCTCGCCTGCCTCGCCTGCCTCGCCTCCTCCCAAACTCTCTGCCACGACTCTGACAACACCAGCAGTGGCCTCGT
TCGACCGCCGCCTCCACCACCGCCGGAACGCGTCCAGCTCGACTACACCTGCCTCGTCGCCGGCTGTCGCTGCCGCTGTC
TCCGTCTTCCGCTCTCGCCATTCCGAAGACGACGCTGTCCACCACGGCCTCTCCAAGATGCTCCAGAAGCGCCGCCGCGA
CGGCCACCAACACATGTCCACCATGGACTTCCCCGAGCGGTTAAAGGTCGCCACTGACGGGGCCGAGGACGAGGAAGTCT
TGCGACCAAACGGCCAGTCAAACGGCGTCTTCATGAACCTCAATCAGAGCATCTTTGGCCTGATCGCCGCCGCCGGCTCG
ACCGTCAACTTTAACAACCGCTTTGAGGGCCAATCGAGCGACGAAGGCGACGATGAGGACGATGAGGACACCGACAAGAA
TGAGGCCGATGATAACAGCAGATCTCCTGCGTTGGACGGCACATCCGAATCGCAGAGAGCCGCCTGGCTGGCCAGAAAAC
GACATGATGGCGACTCGTCTGCAGATCGGACCGATAAGAAGGACAAGAGGAGAAGCAAGGACCTCTCACAGTCCAACCTA
TTCTCGCGCATCTCCGGCGGAAGCAGTAACGTCAGTCTCGCCGACAAGCCGGGCGATCGGCACAGTCGATTGTCTGAGAA
CAGGCTGCTACGGTCACTGCCGTCCCTGAAGACGAGATTGTCCGTGAGGCACAGTCGTAAGACATCCAAGGAGGCCGGCA
CGGTCCCGTCGACGGAGAAGCAGACAGGCAGCGACAGCAGTAGGAGAAGAAGCAGGATCGACGAGGAAGACGAAGAACAG
GACGACAGGGCGCCGACGCCGACACCGGCGACAATAACGCGGACAGGCGCACCGGCACCTGCTGTGACTTACGTGGTGTC
GCCGGTCGACTCGTCGGCCTCGGTCGCAGTCAACGACGATGGCCTCTCGGCCTCGGTCTTGGCGCTCCCTCGTGGCGAGC
GCAGCAACAGCGTCCGCAGCATCGCTCCGGTGATGAGCCGCATGCTCGAGGCCAAGGCTGAGCTGGCAGCCCGGCCGAGC
TTCGACTTTGATCGGCGCTCCAGCGACAAGAGCCGGACGGCCAACAACGACAGCAACGACACGGACGTCGACTCGGACGA
CGCCATTGGCTCCTCGGCCTTGGCTCGCAAGCTGATGGAGATCTTCGACTTTGAGAAGCCCGAGGAGGTCATCGAGGAGT
ATCCCTGCTGGCTGCTGCAGAGCGTATTGCTACAAGGATACATGTACATTACGGCCAACCACATCTGCTTCTACGCCTAT
CTTCCCAAGAAGGCGGTGAGTGTTTTTGTCCTTTGTCTTTGACCCTTGTCCTGCTCTGTCAGTTTCCGTCCACTGACTCT
ATCAGAACGAGGTCTCCAAGTCCGGCTACCTGGCCAAGTCCGGCAAGCGAAATCCAAAATACAACCGATACTGGTTTCGG
CTCAAGGGCGACGTGCTCGCCTACTACCGCGACCCATCCAATCTGTACTTCCCCCACGGCCAGATCGACCTGCGCTATGG
CATCTCAGCCACGGTCACAGACCGCGACAAGGACGGGGTGCACTTCCAGGTGGTCACGCACCACCGCACCTACTACTTCC
GGGCCGACAGCGCCCCCAGCGCCAAGGAATGGGTCAAGAGCCTGCAGCGCGTCATCTTTCGCTCGCACAACGAGGGCGAC
AGCGTCAAGATCTCGCTGCCCATTGCCAACGTCATCGACGTGGAGGAGACCCAGACGATGGTGGAGTTTGCCGACACCTG
CAAGATTCGCGTCATCGACAACGACGAGACCTATGCGATCGACGAGTACTTCTTCTCCTTTTTCGACTACGGCAAGGATG
CCGTCCGCGTGCTGCGCATCCTCATCGAGGACGCCAACCAGCAGCAGCAGTCGCCCAAACGAGGCCGGGACCACACAGAC
GAATCCCTTGCGCTGCGTCTGCAGATGCGATCGACCGCGTCGCCACAGCAGTCCGCCGACGATGCAGACGAGTCTGCGAG
CGCCTCTGCGCCCGAACGGGGTCCTGCTGCTCCGGGCGCAAGCGGCAGCTTCAACGGCAACATTCCCGCTGTCGCTTCGG
CGTCGGACAGCCGGATCTTGAAGGCGACAAAGCTGCACAGCTCCGTGCGCGCGACTCTGAGCCCGGTGTCGCCCCCCACC
AGTCCCCGGGTCAGCGGCGAGTTTCCGCGCAGCAGCTTTGATGCCCTGCGCACATCCTTCAGCGGACGTCGCAGCCTGGA
CACGAGCGTGGCTCAGCTGGGGGAGGCCCCGCCACGGCGCAGCTTCAGCGACTACAGCCGGCGGTCGCTCAGCACAGACC
GCGACCGCCGGCCTGCGCGGTCATCACGCCAGCAACAGCAGCGGCACCCGCTCGCAGGCTCGACCGACTCGATGGTGCCG
CTGTCGTCGATGGACCCGAGCGTGGCGAGCCTGTCGGGTCTCGTGGTCTCCTCGACCGAGAACGACCAATCGTCGGCCAG
TCAGATCCTGCACGGCAGCGAAATCTTCAAGGGCCCCACCATTGTGCACCGGTCAGCCTCGGCGTCGCGTCGGCGGGAGG
GCAAGCGCGCGTCGTGGCAGCCAGGCAGGACATCAGGGTCAGCACGGCACTTTGACAGCGGCCGTGTCGGTGACAGCGAG
CACGCGTCGTCGGCCGACTCGCAGACGTTGCCGTCGGACATTGCCACTGGTGGCGGCGCGATAACGCCGGGAGGCACGGC
CAGCCTGCAGCGTCTGGCCAAGATGGGATCCTATCCGCTGCAGCGAGCGGGCGCCTACGCCGGATGGCTCAACCAACAGT
CACGGCGGATGAGTTCGCTGCTGGCGACCGAGTCGATGGGCTACGTCGAGAAGGTGTCGGGCATGTGGAAGGGTGGACAT
CGACACTACAACGAGGGACCCGGGCCCGGATCCGGGCTCATGCGCATGGGCGAAGAGCTAGACGACGACACGGCCGGCAT
GGGCGGTGCTGGTGGCGAAGGCGAGGCGCCGGACCTAGCCGTCATCAACGAACGGTTCCGCGCACACTTTGCACTGCCGG
AAACGGAGCGTCTGCAGGCGACGTACTTTGGCTACCTGATGCGGGTGCTGCCGCTGTACGGCAAGATCTACATCAGCGAC
CGGTCGTTCTGCTTCCGCAGCCTGCTGCCAGGGACTCGGACCAAGCTGATCTTACCGCTGCGCGACATCGAGAATGTGAC
GAAGGAGAAGGGCTTTCGGTTCGGCTTCTCGGGCCTTGTGGTGGTAATTCGCGGACACGAGGAGCTCTTCTTTGAGTTTG
GCCAGGCCGAGATGCGCGACGACTGCTCGGTGACGCTGTTACGCGGCTTCGAGTCGGCCCGCTACCTGCGAGAGTCAGGT
CTGCTGAACGAGGACGAGAAGGCGGGCGCGCAGACGGCGCTGGCCGAGCGAGACGCCCTGCAGGAGGCCCGACAGGCTTC
CCGAGAGGGAGAGGAAGGTGGTGGCGAGAACGACAACGACAGCACGCCGGCAGCAGCCAACGTGATGAGGCTGACAGAAT
CACCGACAACGATCCTGTTTGACGACCCGCGCGCTTCGTTCCTCAACTTCAAGCCAGCAGAGCCTCTTCGGATCACGTGC
CTGACCATTGGATCGCGTGGTGATGTGCAGCCGTACATTGCGCTGGGCAAGGGCCTGCAAGCAGACGGACACCACGTGCG
AATTGCGACGCATCCCGAGTTCGAGGACTGGATCCGCAGTCACGGGCTAGACTACGGCCGCGTGGAGGGCGACCCGGGCG
AGCTGATGCGGATTTGCATCGAGAACGGCACGTTCACGTTGCAGTTTCTGCGCGAGGCCAATTCCAAGATGCGCACCTGG
CTGGACGAGCTGCTGGCATCGGCATGGACGGCGTGCCAGGACGCGGAGCTGCTGATCGAGTCGCCGAGCGCGATGGCGGG
CATCCACATTGCTGAGCGGCTGCAAATTCCCTACTTCCGAGCCTTTACGATGCCATGGACGCGCACACGAGCCTATCCGC
ACGCCTTCATCATGCCAGAGCACAAGATGGGCGGGGCGTACAACTACATCACGTACGTCATGTTCGACAACATCTTCTGG
AAGGCAACGGCGTCACAGATCAACCGGTGGCGCAACAAGATGCTGGGACTGCCCAACACAACGCTAGAGAAGATGCAGCC
GAACAAGGTGCCGTTCCTCTACAACTTTAGCTCGTCCGTGGTGCCGCCTCCGCTGGACTATAGTGATTGGATCCGCGTGA
CCGGGTACTGGTTCCTGGACGAGGGCAAGAAGGAGGGGAAGGATGGAAAGGATAAAAAAGACGAGACCCCCCCCTGGTCG
CCGCCACAGGACCTAGTCGATTTTATCGCCAAGGCGCGACAGGACAAGAAGAAGCTGGTGTACGTGGGCTTCGGATCGAT
CCTGGTGCCGGACCCGGCCAAGATGACGCAGGAGGTGATTGATGCGGTGCTCAAGGCAGACGTGCGCTGCGTCCTGTCCA
AGGGCTGGTCGGATCGGCTGGCGGGCGACAAGGACAAGGCCGACGACGACGACCACACGCGCGTCGAGGTGCCGCTGCCA
CCAGAGTTGTTCCAGATCAAGTCGGCACCGCACGACTGGCTCTTTGCCCAGATGGACGCGGCCGCGCATCACGGTGGCTC
CGGCACCACGGGTGCATCGCTGCGGGCTGGCATCCCGACCATCATCCGGCCCTTTTTCGGCGACCAGTTCTTCTTTGGTG
GCCGTGTCGAGGATCTCGGCGTCGGCATCTGCCTCAAGAAGTGGGGAGCGACCAGCTTTGCGCGTGCTCTCTGGGAGGCT
GCCAACTCGGGCCGGATGATCAAGAAGGCAGCCGCATTGGGAGAGCAGATCCGACAGGTGAGTGTCAGCGTGCATTTCCT
AGTCGGTCTATTGATACTAACACAACGGCAGGAAAACGGCGTCGATACCGCCATCCAGTGCATCTACCGCGACATGGAGT
ACGCCAAGTCGCTCGTGCGGGCCAAGGCCGGCAAGACGACTGGCCGTGGCAGCGAGACCGGAGCTGCCGGCCGCACCGCT
GCTCCTGACGACTACGAGGAGGAGCCCGAGGAGAGCTGGACGTTTGTCGGCAACGACGACAGCAACAACGTGCACGGCGC
CGACCTCATGCTGCAGTCGGTCATTCTCAGCCCCGACGGCGGGAAATCGGGCAAGGCGCTGGGCAGCCGGGTGTTGGGAC
AGGTGGCTGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62