GenePrediction:GLEAN_2917 Details

Name: GLEAN_2917
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4176526..4177738 (+ strand)
Length: 1213
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4176526..4177174 (+ strand)
Length: 649
Type: CDS
Source: GLEAN
Position: GCSC_140:4177239..4177738 (+ strand)
Length: 500
>GLEAN_2917 class=GenePrediction position=GCSC_140:4176526..4177738 (+ strand)
ATGAAGGGAACTCTGGAGCTTCTCGCATTGGGTGTTGCCATTCCCCTTTCTCGAGCTTTGGTCGAAGTTACGCCGATAAC
AGGCACCTACACGATCGACATGGTTCATAAGGAGATCAAGATCCGCGACGCACACACGACTTTTGAGAGCATTTTGCGCT
GCCACAAGCAGAGCGGCCAGGACCTGACGCTTGACGACAACCGAACGGTCGTGTCCTGCTGTCTGCCTAGCCAGCACCTA
TCCGGTGTCAATGGCGCTGCCTGGGACTGTTGCGGCGCAGGCCACGAGCTGTCTGGCTGCGAGGCAGAGGGCTACTCTTG
TTGCCCTGCGGGCTATACGTACCGTGGAGGCATGTGTTACCCACCGGAGGACAGTCGTCAGCAGCCTCTGCCACCGCCCA
AGAATCAAGGGCAACAGTACCCTCCACCGCCGCCACCACCGGGACCACCGCCGATCGGGCCTGGTGGGTATCCCTATCCT
CCACCACCGCCACCCGGGCCAGGTGGACATCCCTATCCTCCACCACCGCCACCCGGGCCAAGTGGCCTGGTCTGGCCGCC
ATCTCCTTGTCCCAAGGGAAGCACACTGGTCAACGGCGTCTGTACGGGGCCGATGCCGCACAAGAAGTGCGAGTCTGGCA
TCCGCGAAGGTATGGCCGGATCGAGGAAATCCTGCAAGCACGTTGTGCGATACTGACACCTATTCTCTTCCAGGCAAATG
CTACCGCTTCAAGAGAAACCCAGACTGGTACTTAACTTCCAAGGGCAACGACTATCAGCTTGGGACGCCTACCAGGGAGA
CGCCAGCCGGTAGTTTCCAATTCTGCAAAAGCTTTGGCTGCGACGGCACACACGCAATCAACCCCAGCGACAAGGTGTAC
ATCCGCGACTTCAACAACGGCAAGGTCTGGCTGAACAATGCCAATGGCGGTACGCACATCGCTGGCACTGTCAAAACGAG
CGAGGCCGGCACCTTTTCTATCACCAAATGGGCTAAAGGCGACTACTGCCTCACAGGCTTTGACGCCGGCTTGCGCAAAG
CCTGTCCTGCAGCCACGCCTGGTATCACTCAGGATAAGGCAGAGCATGATGACTGCCTAGATTTCGAGATCTTAGAGGTG
CCATGTGACATCCGCTCGGACAAGAACAATTGTTTGTGGGGGACGACAGGTGGAGACTGCGGACAGGCTGAAAGGACTGT
CCCGTGTCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62