GenePrediction:GLEAN_2918 Details

Name: GLEAN_2918
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4181331..4182189 (+ strand)
Length: 859
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4181331..4181388 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_140:4181450..4182189 (+ strand)
Length: 740
>GLEAN_2918 class=GenePrediction position=GCSC_140:4181331..4182189 (+ strand)
ATGGCTTCTCTGGCTCGACTTCCGGGTGTTGCACTGATCAGTGGCGCAGGCGGCACAGGTAACAACGAGTCCTGTCTCGT
CTGCCGTCCCCTATTGTCCCGTTCTGACTGTCTTCTTAGGCATCGGAGCAGCCGTGAGCAGGGCTTTTGCTGCCGCAGGC
TGCTCCCGCTTCGCCATTACGGACCTGGATGCGGCTTCGCTGCAGGCGACGGGGGCTGTGATCCGCAAGATCAGCCCCGG
CGCGGCGGTCTTCGCGGCCGATGGCGACGTGTCGGACGAGGCTTTTGTCTCGTCCTTTGTCGGGGACGTGGTGAGGCGAT
TTTCACGTATAGACTATTCCGTCCACTGTGCCGGCATCCTCGGCGCATCGCTGCGCTCTCACGAGACGCCGACAAGTGCG
TTTGACCGTATCAACAACGTGAACTACAAGGGCACCTGGCTCTTCTCCCGAGCATCGCTCGGCCAGATGGTACAACAAAA
ACCCCTGGACAGCCATCCGAAGCAGTGCGGCGCCATTGTCAACATTGCCAGCCAGCTGGGCATTGTGGCCCGGCCTGGTG
CAGCGCCATACTGCGCGTCCAAAGCGGCCATCATCAACATGACCAAGGCAGATGCCATCGACTACTCGCTCGACGGGATC
CGCGTCAATTGTGTGTGTCCAGGCGTCATTGCCACGCCAATGACAACAGGCTCAACCGAGGTCGAGGAGCGTTTGCGGCC
GGCCGTGTCCATTGCCCCCATGCAGCGAATGGGCACGCCCGAAGAGGTGGCAGATGCGGTGCTCTTCTTGTGCTCGGCGC
AGGCGTCGTTTATACAGGGTCATGCCTTGGTTGTAGATGGAGGCTATACGATCAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62