GenePrediction:GLEAN_2919 Details

Name: GLEAN_2919
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4184334..4185321 (+ strand)
Length: 988
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4184334..4184439 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_140:4184492..4185321 (+ strand)
Length: 830
>GLEAN_2919 class=GenePrediction position=GCSC_140:4184334..4185321 (+ strand)
ATGGGAAAGAAGCGAGTTCTTGTAAGCTACGGCGTCGATGTCGATGCCGTCTCGGGCTGGCTAGGCTCGTATGGAGGAGA
AGACTCGACCAACGACATCAGCAGAGGTATGCGCTCGTCTGCGTCGTTCGAACGGCCGACCGCAGCTGACCGAGACAGGC
TACTTTGCCGGCACCATCGGCACGCAGCGCATGCTCCAGCTATTTGCCAAGTATGACATCAAGGCCACCTGGTTCATCCC
GGGCCACTCGCTCGAGACCTTCCCGGACGACATGGCGGCCGTGCGGGATGCCGGCCACGAAATCGGCCTGCACGGCTACT
CGCACGAGAACCCGACGGACATGACGCTGGACCAGCAGCGCCAGGTGCTCGACCGGACGTACCGCCTGCTAACCGACTTC
TGCGGCGGCCGCCCGCCGCGTGGCAGCGTGGCGCCGTGGTGGGAGACCAGCGTCGAGGGCGCGCAGCTGCTGCTGGACTA
CGGCCTCGAGTACGACCACAGCATGAGCCACCACGACTGTCAGGCCTACTACCTGCGCACAGGCGACACCTGGACCAAGA
TCGACTACAGCCAGGCTGATGCGGCCACATGGATGAAGCCGCTCGTCCGGGGCAAAGAGACCGGTCTCGTTGAGATCCCT
GCCAACTGGTACCTCGACGACTTGCCGCCAATGATGTTCATCAAGGCGGCACCCAACAGCCATGGGTACGTCAACGCGCG
CGACGTCGAGGATCTCTGGCGCGACCACTTTGACTACTTCTACCGCGAATACGATGAATTCATCTTCCCCCTCACCGTCC
ACCCAGACGTCTCGGGTCGGCCGCACGCCCTGCTGATGCACGAACGACTCATCGAGCACATGAAACGCCACGAGGGCGTC
GAGTTTGTCACCATGGCCGAGATCTGCGACGAGTTCAAGAAGAAGAACGACCCGGATCCGGGGGCAGCCTTGCCGGCCAC
TCCAGGACTGATGCTTGCAAAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62