GenePrediction:GLEAN_291 Details

Name: GLEAN_291
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:807374..808170 (+ strand)
Length: 797
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:807374..807425 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_167:807503..807555 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_167:807632..807705 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_167:807769..808103 (+ strand)
Length: 335
Type: CDS
Source: GLEAN
Position: GCSC_167:808160..808170 (+ strand)
Length: 11
>GLEAN_291 class=GenePrediction position=GCSC_167:807374..808170 (+ strand)
ATGGGCAACACGACGAGTGCTGTCCTGGACAACATTGTCCAGGGGACGAACTGTGAGTGTGGCCCAGGCTCTGGCCAACA
AGGACAACATGGGAGAGCAGCGATGCGAGGCTAACACGACGCGTCGCAGTCGACCGGGAGGAGGTCGACCGCATAAAGAA
GCGGTTCATGAAGCTCGACAAGGTGCGAATGGACAGGGCTGCGCGGCCGGGCGACGGGGACCGATCTGTGGCCAGACAAG
ATGCTGACGATAGTGCAGGACAACTCAGGAACGATTGAGCGCGACGAGTTTCTGAGCCTCCCGCAGATTGCGTCGAACCC
GCTAGCGACCAGGTGTGTTTCGTCTTTCTTGTTTCGGGCGTGTGGCGGTGAGGGACGGACAGCTGACGCGCACAGGATGA
TTGCGATCTTTGACGAGGACGGCGGCGGGACGGTGGACTTTCAGGAGTTCGTGTCCGGGCTCAGCGCGTTCTCGTCCAAG
GGCAACAAGGAGCAGAAGCTCAAGTTTGCCTTCAAGGTGTACGACATCGACCGGGACGGCTACATCAGCAACGGCGAGCT
CTTTATCGTGCTCAAGATGATGGTGGGCAACAACCTGAAGGATCAGCAGCTGCAGCAGATTGTGGACAAGACGATCATGG
AGGCCGACCTGGACCAGGACGGCAAGATCAGCTTTGAGGAGTTCACCAAGATGGTGGAGAATACGGACGTCAGCATAAGC
ATGACTCTTGGTCGGTATTCCCTTCTTTTCCCTTCTTCATCCTTCCCTGCTAACGGCGGAATGCAGACCATTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62