GenePrediction:GLEAN_2920 Details

Name: GLEAN_2920
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4185957..4187492 (+ strand)
Length: 1536
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4185957..4186143 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_140:4186203..4186627 (+ strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_140:4186779..4187492 (+ strand)
Length: 714
>GLEAN_2920 class=GenePrediction position=GCSC_140:4185957..4187492 (+ strand)
ATGGCAGCCACCGAGGAAAAGGGCGTCGATGCCATCGAGGCCGCGCCTGTGCGCACCAGCAGCAGCAGCATCGAGGCCGC
CAAGATGGACAACGCGGACGAGGCCTTTGAGGTCTTCAAGAGGGGTGACGGCAACGTGGACTTCCGCACCGTCAGCTGGA
TCCACGCCTCCGTCATCTTTCTCAAGGGTAGGCAGTCTGTCGCTTCTAGACCGTGCAGGCGCTCCCACGCTGACGTCGAT
GACCAGTCATCTTTGCCACCGGCGTCCTGAGCATCCCCTCGACCATGTACGTGCTCGGGGCCTTTCCCGGCGCCGTCAAC
GTGCTCGGCTGGCAGGGCCTCAACACGTACTGTGCCATTGTGCAGGGCAACTTCCGAAATGCCCATGCTGGCTGCCACTC
CATTGCCGACATGGCCCATGTTGTCGGTGGCCCGTGGCTGCGCGAGATCGTCGGCGTCCTCTTTCTCGTCACGTACGCCA
TCGTCGGCGCCTCAGGCATCTTTGGGGCTTCAGTCGGGCTCAACGCGCTGTCTGACCACGCGATCTGCACCAACTACTTT
ATGCTCGTCGCCATGGTGGCCGTCTTCATCTTGGCCAGTGTGCGCAAGTTTGAGAAGATTGCCTTTTTGACGTGGGCCGG
CTTCGCGTCTGTGTATATTGCCGTCTTTATTGTAGTGTACGTTTCTCGCCGATTTTCTCTTCGCTCTTCTTCTATTTTCC
CCCCTAACCCCCCCTCCTTAGTATCGGTGTCACCACTCGTGACCGGCCTGCCTCGGCTCCCCAAACTGGCGACTACGACC
TTGGCTACCATGCCATTGGCAGCCCGACCTTTGTCCCGGCATCACGTCCGTGGCCACCATCTTCTGCTCGGGTGCCGGCA
CGTCTGCCTTCTTGCCTGTCATGTCCGAAATGCGCCGTCCCCGCGACTACAACAAGGCTGTGTACCTCTGCATGAGCATT
GTCACGGCCTCGTACCTCTGCTTCTCGCTCGTCGTCTACCGCTGGTGTGGCCAGTGGGTCGCCTCACCCTCGCTCGGATC
CGCTGGCACCACCATCAAGAAGGTTTCCTACGGCATCGCCATGATCGGCCTGCTCGTATCTGCCTGTCTTTACGTCCACG
TCGCCGCAAAGTATCTCTTTGTGCGCATCCTGCGCAACTCCAAACATCTCCAGGACAGTGGCCCCGTTCATTGGGCCGTC
TGGCTCGCCTGCACCTTCGGCATGTCCGTCATCTCCTTCCTCCTCGCCAATGGCATCCCCATCTTCAACTATCTCCTCGC
CCTTGCCGGCAGCCTTACCTTTGCACCCCTGGCCCTCGGTCTTCCCGGCTACCTCTGGATCTACGATCACCCGCAGTACC
GCACCGGTGGCTTCTGGCAGGCCTCTGCGTACTGGCTCAACTGGCTGTTGATTCTGCTAGCTGCCTTTTTGACCGTCGGC
GGCACCTATGGCGTGGTCCAGAACATTATTGATGCCTATGCCAGCGGTCTAATTGGAGGTGCCTTTTCCTGTGCTGACAA
CAGCAATTCGTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62