GenePrediction:GLEAN_2921 Details

Name: GLEAN_2921
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4191525..4192432 (+ strand)
Length: 908
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4191525..4191564 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_140:4191624..4192432 (+ strand)
Length: 809
>GLEAN_2921 class=GenePrediction position=GCSC_140:4191525..4192432 (+ strand)
ATGCTGGCCTGGATAGATGAAAAGGCCATCCATGCAGCGGGTGCGTATTCGCCAACCCATCCGTCGTTGGCAAAAGATCG
AACCCACTCATCACCGCAGTGCAGCATCCGCCTGGAAAGCCCTCTTTCGTCAATGGAGGCCTTGCAAAGGCAGACATGCA
GGTCGCCCTCATCGACATCGACCAGGCGTCATCCAAGCCGCTCGACTCCTCCGACATCGTCCAGCTCCTGTCACAATCGA
CATTTGCCAGCTGGCTGCAGGGCCCCGAGCCCCAGATCCTCTACATCAACGGCCACTTACAGCTGGAGCAAGAGCAGGAG
ATGGCGTCGCCGCTGACGCTCCTGACGTGTGCCCTCTATGTGTCCCTGCAGCGGCACAGAAGCGGCTACGACATCGCGGC
GATGCACCTCTGTGGCCAGCACGCTGTGCCCAGCGACCTGTTCGCCAGCATCGTCGGCATAATGCGGTCGTTCGCCGCGC
AGATCCTGTACCAGCTGCCGGCCGATGCGCTCGACCTCTCGTTCATTGACCTCTCGTTCATCGAAGAGCTGAGCCGCGGT
GACCCCAGCGCTCTCAGCAGGCTTCTCGCCCGTCTCGTCTCCGACGCCGCCTCGGTCGGCCACAGGGTTGTGATCCTCAT
CGACGGCGTCTGGCGGCTGGAAGAAGGACCCGCGGCACCCGAGTTCAATACGCTCGTGGACTTTTTCAAGGACCTGGTCC
AATCATTCCATGCGCGAAGATGTCCTTATCTAAAGGTCTTGTTCACGAACCCCGGTAGTAGCATCCACGCCCGACAGTGG
CTTGCCGACTGCCCGTCGTCCATTCTCGACCTGGATGGTGCCGGCTTTGCTGGACAGGGAGATGAGTTTGGCTGTGGAGA
CGATTACTATGATGACCAGCAGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62