GenePrediction:GLEAN_2922 Details

Name: GLEAN_2922
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4197425..4197992 (+ strand)
Length: 568
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4197425..4197445 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:4197502..4197777 (+ strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_140:4197849..4197992 (+ strand)
Length: 144
>GLEAN_2922 class=GenePrediction position=GCSC_140:4197425..4197992 (+ strand)
ATGTCGGGCAGTCTGAAAAGTGTAGGTGCATGCGTCCACGGTCGCCGCCTCGCACACCCCCAATTCTGACCTTTCAGGCT
CTCCAGAAGCAGTACAAGGCGGCCATCGGCCGCTGGCCAAAGGATGACCTGCGGCCAGACGTGCAGCTGCCGGACATTCT
GTCCAAGCACCTGGCCGACCGTCTAGCCGGTCGCTCGCTCGCCCGGCCCATTCTTCGTCCCAGCGGAAGTCTCGTTGATG
GCAAAGACGCGGCCGCACTGTCTGCTGTCGCGCCCGCACCGCCCTCGGATCTGCAGCAGCTGCGCCAGATCAACGCCCTT
TTCTCTCTGCTAGACGACCGGTACAAGAAAGCGGTGAGTCTTCCAGCATTGCTCTTTTGCTTGACGGGTAGAAACAAGAC
TGACTGACCAATTCCACCATCCAGAACCGCATCACCGGAACGCTGATGACGCCCCGCAGCAACCCGACCTACTACACCGA
CCTCGTCACCGAGCTGCAAGAGGCACCCAAGCGCAGTCTGCTCGGACGCATCTCCAAGCGTCTCGGCGGCATGTTCCGGC
TGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62