GenePrediction:GLEAN_2923 Details

Name: GLEAN_2923
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4203629..4204240 (+ strand)
Length: 612
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4203629..4203679 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:4203879..4203985 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_140:4204039..4204240 (+ strand)
Length: 202
>GLEAN_2923 class=GenePrediction position=GCSC_140:4203629..4204240 (+ strand)
ATGCCTCAGGATATGCCGCCGGTCGGCGGCTACGGCGCCGTGCAGTACAAGGTGAGAGGAGGAGTGAGAGAAGCGAGAGG
AGACGCATTGAGCAGATGGGAGGCATATGCGGCCGGTCCTGCCAGTCGGGGCCCAAGGAGCCGAGACTGCGAACAGTGCA
AATCCCTATTCAACTACTCAACTACAAAACCACACAACCTCAACCACAACACACAACACATCCACACCTCACCATACTGA
CTCTGCACAGAGAAACCTTCCGTCCCGCGGCTTCCGCCCGTCTGTCCTTCTGGGCATCAGCGGCGCCGTCATGGCCTTTG
GCTGGTACAAGCTGGCCCAGGGAATCCGCGAGCAGCAGTAAGTGTACTCATTTGTCTTTCCGCTCTCCGGCCACCCGTCT
GACAGCTTAGCGAAATGGCCCGCGAAAAAATGTGGTCGCGCATCCACTTGATCCCGCTGCTGCAGGCCGAGGAGGACCGC
GACCAGGTGCGCCGCCATCTGGCCGACCAGGCCCGCGAGCGCGAGCTGCTCGGCGAGAACGTCCGGATCTACAACAGCGA
TCGGTTCGTGCGGCCGACCTTTGCGGCCACGCCCGGGAACGTGTCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62