GenePrediction:GLEAN_2924 Details

Name: GLEAN_2924
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4208737..4211811 (+ strand)
Length: 3075
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4208737..4208889 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_140:4209094..4209166 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_140:4209230..4209786 (+ strand)
Length: 557
Type: CDS
Source: GLEAN
Position: GCSC_140:4209913..4210445 (+ strand)
Length: 533
Type: CDS
Source: GLEAN
Position: GCSC_140:4211105..4211148 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:4211370..4211386 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_140:4211773..4211811 (+ strand)
Length: 39
>GLEAN_2924 class=GenePrediction position=GCSC_140:4208737..4211811 (+ strand)
ATGGCTGGCCTGCGAATAAAACGGGCCGAGGCTTTCACGATCCACGAAGATGCAGCGTCGGAGGAGACACAGCTGAACGA
AGACCTGATACCAACAGAAGCGAGCTCGTCTCAGCAGCAGGCCTACGGCGAGATAGAGGACGAGGACGATTATGTAGGAG
TGGAAGTTGCAGACATGGGCGACGACGACGTCGGGAATGACAACGGCATGAATTATGCGGATGAGGAAGACGACGACCAC
GACACTGGGCACGATAATGACATTGACAACGAAACGGAAGAGCAGGATCAGGACCACGACGAGGAGGAAGCGCCGGACAG
CTCCGACGACGAGGCCGTTGATGAGACGGTGCAGCAGGACATGGAGAAGCTGCAGAAGACATTTCCCAGCTTCCCGCAGC
AGTTCCGGTTGATCAAGCGGATCGGCGAGGGTGGGCGCTTTTCTTATCCCAAGCTTTCCCCTTGACCTTCTGTCGTCTAA
CATGCATGTCTAGGCACTTTTTCGACCGTCTACAAGGCTGAGGATCTGCAGTACGACCGCTTTGACAATTCGTGGGACTG
GGAGAAGGAGAAGTGGGCATCACCACCGGTGAGGCGAACGGGCCGACAGCAGCACGCACAGACACAGCAAAAGCGTGGGC
GGCGCAGCGCCAAGTACGTGGCGATCAAGAAGATCTACGTGACGTCGAGTCCGCTGCGGATCTTCAACGAGCTGGAGCTG
CTGCACGACCTGCGCGAGTCGCCGTCGGTGTGTCCGCTGATCACGGCCTTCCGGCAGACGGACCAGGTGGTGGCAGTGCT
GCCGTACTTCCGGCACCAGGACTTTCGGGCCTACTACCGCGACATGACGGTGCCGGACATGGCCATCTACCTGCGGGCGC
TCTTCACGGCCTTGAGCGCGGTGCACGCGTCGCGCATTCTGCACCGGGACATCAAGCCGACCAACTTCCTGTACGACCCG
GCGACACAGCGCGGCGTGCTGGTGGACTTTGGCCTGGCCGAGCGCGAGGGCAGCGACAGCAAGCCGTGTCTGTGCCATGA
GCCGGACAGCGTGCGCAAGAGCCGACTGCGAGCCGCCTATGCCAACGGACCGATGGGCAGCGGTGTTGTCGGCGGTGGTG
CTGCTGGTGGCGGTGGCGGTGGTGCGCTGGGCGGTGCGCACAACGGCTATCCCAAGAACGACACGCGGCCGGCGAGACGG
GCCAACCGGGCAGGCACGCGCGGATTTCGGGCGCCCGAGGTGCTGTTCAAGTGCACAGAGCAGACGACCAAGATCGACAT
CTGGTCGGCCGGTGTGGTGCTGCTGACGCTGCTGTCACGTCGGTTTCCCTTCTTCAACAGCGCCGATGACGTCGAGGCCA
TGATCGAGATCGCCACCATCTTTGGCAGCAAGCGCATGAAGGTGGCCGCCCAGCTGCACGGGTGCATGTTCGAGACCACC
ATCCCGACCGTCGGCCGCGAGGGCTTCAGCCTCGAGAAGATCATCCTCTGGAGTACCTGCCGCATGGACAACAGCAAGAC
CCTGCAGCCGCTGACCGACGAGGAGCGGCTGGCCGTCCGCTTTCTTGGCCGCTGTCTGGACCTCGACCCCAGCAGCCGCA
TCAGCGCCGACGAGGCCCTGGAACATGAGTTTCTGCGCGAGCGCCCGCTGGGCACTGACGTCATTGCAGGCACCAACAGC
GAGGACGAGGAGGAAGAGATGGATATGTTGTAAGCGGGCGGCATGGCAGTGCATGGATGGCGGAGCGGGTTACCAAAAAT
CATACATCATCTTACATATCAGGGCGGACGGCAGCATGTGCATTTTTGGCTCTCATTCTCGCTTAGCAATATACCTTGCG
AAGGTGAAAATTCTTCATTACAATCTTTCGCTCGAAATTTGTATAAATTAGATAATTGTCGGCGAGCACTTGAAATTCAA
GTGCTCTGTATGATTGAACTGAACGAGCCGCGGCGCCGTAATCATCGAGTTGTACGATTTGACCCCTTCTCCATCCGTCA
ATGTCTGGCGCTGCATGTGAAATAAATAGAGACAGCTAACGGTTTTGTTGATTCACATGCCGATACTGTACGTCCTTTGT
TGCTTCGATACGAGCCCTCAAAACCTGCCATCCCCTTTTCCTTCTTATTCCCATACGAAACGCCCATTTTGTCTTGATGT
GGAGTGTGTTCCTGTGTAGCTAACACTGACCAATACTCGCAGAAGTTCCTGAAAGGGTACATATTTTGTTGTTGTGGTTT
CGGCTCAAAGATTGCCAGTTTTAGCACAAGCTTAGCCAACGCTGGGAGGCTAATATGGAGTTATCATTAGGCATGCATAC
AGACCAATTCATGGTCTAGATACAATAGTCAGATGAGACTGCCGCCAGTCTAGAGATGCTGGACAATGCCGCCAGCATCG
TTGTCCAGGGCGGTTCGCCCTCCCCTGCCACCAATATTGCCCCGGGTGGCGACCCTGCCCTGACTCCACCTGCCGGATTC
TAAGAAATGAGGCGTTCTGATCGACGTGTATATACCTGCAATCTTAAACCCATATTTCTATACTAACATCAACGGTCTTT
AGCTTCTGATAATCGTGATGCTCATCATTTGTACCAGCTCTACTCGCATAATGCTAACACATGTTCTTAGTAGAAAAGGG
TCAGTTTGGGGTAAGTTTCAAGTTTCCACACTGTCGTTCTCATCTTGTACTAACGACGTGTTGCAGCATATCGAAGGACA
AGTAGCTGTAAGTATATTGCTGCTATCGAAAGCTTATTGTTACTGTCTTATGCTAATGAACGTATAGGTTTTGGGGGTTT
AGCTTAAAGCAAGCATTTCAGTCGTTATCGGAAAAGCTCAAATTTAAGCAAACAGCATTAGATTTCTTCAGACTAAGAGG
CACAATATAGAAGTGAACCAAGAATTGTTTCCGCGGTTTTACTGTTTGACTGATTGTTTCATTGGAACGGACGGACTCTT
CTAGCAGTAGGCTTTGCTCACTTTGCAGAGAAGTTAAGACTGAACTTTTGTCTTTACTGAACTAACACAATCGTAGGCCT
TCGAAAAGCAATACATCTTTCTTAACGAGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62