GenePrediction:GLEAN_2925 Details

Name: GLEAN_2925
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4212360..4212839 (+ strand)
Length: 480
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4212360..4212438 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_140:4212502..4212554 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_140:4212612..4212839 (+ strand)
Length: 228
>GLEAN_2925 class=GenePrediction position=GCSC_140:4212360..4212839 (+ strand)
ATGGCCGCAACAAATAAGCCTCCTGCGAGCGAGAGCGAGCAGCGACCTGACATAGGGAGGCTCCTTCTTGTGCCTGACTG
TGTGATTCATATGTATTATCTCTATAGGTTCGCTATTACTGGGTTTTTCATCACCATTCTAGGTCTCTTCGCAGGCAACA
CGCCCGGTTCCATTAAGGACTACCAGGTTATTATGGTACGTGAAAACCCACCAATCACGGCAGTGCAAGACGCTGCTCTT
TTTCTGCTGCAGCTAAAAAGGTCGGTGTTCGACCGCAACTACGTCCCACAGCTGTACCTCGCCACGGCTGTAGCATCACA
AGCGCTACAAGAGAAGCACCATCCGGAACACGGTCCCGAGTGGCCCAGAAACGACAACAGCAGCAACAGTCCTGTTACGT
ATGTACAGTCCACGCATGCACACTCTGTGCTGGGTGAAATGCAGAGCGCCGCCATGCCGTCGGGCTACCTGTACAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62