GenePrediction:GLEAN_292 Details

Name: GLEAN_292
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:831717..833628 (+ strand)
Length: 1912
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:831717..831816 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_167:831888..832261 (+ strand)
Length: 374
Type: CDS
Source: GLEAN
Position: GCSC_167:832555..833628 (+ strand)
Length: 1074
>GLEAN_292 class=GenePrediction position=GCSC_167:831717..833628 (+ strand)
ATGCCTTCAGCATTAGACACACCGGTGCTACAGGTGGATGCCAATGTCATCCACAAGGTAGACACATCCAACCCGCAAAA
CCTCTTCAGCATGTGGACTGGTAAGTAGACATACGCTTGTCCCTTCTCAGTTCTTCACTAATGAGATCTATAGTTTTTGC
ACGATGCGCAGACTCGGTGGCTCAAGGCCGCCGACTTGAGAACCTCAGCTGGCGACTGTGGACGAGAGAAACATTCTGTG
TCGAAGACACCACACACTCGCCCATCAGCATTCCGTCTGATTCTTTCATGACATCCGCAGATATGTCACCTAAGCCGACT
GCTATTCCTCAGCGCGACCATTCCACAGCAGAAGATGTACCGCAACTTTCTGGCAGCGTGGAGTCTGTCGCCGATGATGA
GACTGAGGAGCTGTCCGGCGAGCCTGGTGCCGTCGAGATCATGCGTCCCAGGATACGGCGACAGGATTCTTGTGGAAGCA
GCCGCAGCCGTGGTCGCGAGAGGCATATCACATCTGACGACTTGGAGAAGATGGTCGTCTCAATTGTTCAAGGGAAGGAA
CCGCTCACGGCTCCCCGCCCGGAAATTTCACGACTTCTTTTCTTTTTACTCCTGTTGTGCCTTCGTCGGAATCGTCCGGG
CTCTCTGCAAGCAGCATTGCAGAACCGCTTTTGTCGGTGAACTCCTCGATGCACACCCTAGTTGAACCTGAAGAACCAGT
ATCGAACGAAGCAGATGCAGCGGCCGACACAGTCACTCCTTCCACACCGACGAGGACAACAACTGTCATTCGCGGTTTCT
CTCCTTCTCATGTTCCTATTCGGATTTCGGATGCTGAGATATCACAACACGATGAAGCCGTTGAAGAGGATGCAATCCCA
GAGCCTACATCTTCGCCGGCTGCGAAGCTGGTCCCGTCGAAGAAGGCTACATTTGCCCTCGGTGGCTCGTCTTCTTGTGA
GGACTCAATGAGTGATCCATCCCGGAGCTTGGAAATGCATCAATCTGCTATGTCCCATATGATCAAGAGGAAATCAGCCG
CCTCTGTTCATAGCATTGCTGGCCCTTCTTCCGCTGCGAAGATTGCACATCCGGAGGAGGAAGGGTCTCTGAAGAGTGCG
ATGCTCTCAGCTCGCAACCTCAACGCACAGAAGAAGCAGACATCGTTTAGCAACCAAGTGATGACGCGAACAATCCCACC
TGCCCCCGTCTTCGAGGATGATTCGGAGTCGGATGACATTGACGAAAGCGCTATCGATGACGACGATGACGATTCGTCGG
ACTGGGAGGACTCGAACGAGGAAAGCGGCCGGTCCAGCATTGACGAGAAGAACATGTTCCAGCGTGTCGACTCGAAGGTT
CACCTACCGTCTCGCAGGTCGCTCATAACTCTCATGATCCAGAAGAGCGAGCGTGAGCTGAAGAATGGGCTGATGACGTC
GCAATCTACGATGGCTCTCTCCCGCCCACGTGTTGCCCGCCAGCCGCCTTCTCTGGTCGCTTCCCCGAACGATTCCGACG
ACGCTGCCCTAATGATGCGCCCTCGGGGACGTCCTCAGTCGAATCTTCGGCCCATCAACGAGATTCCGCGCAGCGCAGCA
CAGCCCATCATGACGTCGGCAGCAGCAGGTGGTCAGTACCAGGCTGCCTATTCGCCACGCACGAACCGGCGCAACATGCT
TTCCACAGAGCTCACGGAGTCGCTTCGTAGACATCTCCTCTGGGAACGGTCACAAAAGACATCTACTGCCAATGCGGTGC
TCAAAAGACGCCATACCTCGCAGGATGTGGCCAACCTGAAGCAGTACCCGGAGACACCCCACATGGTCAAAGAGAACGAC
GCTGGTGCTTCGAGCTGGGATCAGTACCTTAACCGGGACGCTTTCAACGGATACCATGCAAAGGGCTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62