GenePrediction:GLEAN_2939 Details

Name: GLEAN_2939
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4332134..4333281 (+ strand)
Length: 1148
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4332134..4332171 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_140:4332229..4332281 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_140:4332403..4332586 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_140:4332657..4333281 (+ strand)
Length: 625
>GLEAN_2939 class=GenePrediction position=GCSC_140:4332134..4333281 (+ strand)
ATGAGCCTGGCAGTTTCAAAATCTGTTCTTATTACAGGGTAAGAAAACGTGGCTCCCCACTTGACGAGAGCTTCCTGGTG
CTGACCCCAGGCCAGATGCTCACCGGGCGGCATTGGTAATGCTCTGGCGCGGGAGTTTCATGCCCGAGGTAAGAAAGAGT
ACAGCGGCGAGTACGGAGTACAGAGGTCTCATACTCCGTTGCAGTAGAGCGCACGTGCCTCGGCCTTTTCCTCTGTGCAC
GTAGCCCCCCGATTCTGCGAAATTGCCAGCTCACGCCCAAGAAGGATGTCGGGTTATTGCGACGGCTCGTCGGCCAGATG
CTCTATCGGACCTGGCCGTCCTCGGCCTCGAGACCATCCTTCTGGATGTCGACAGTGAGGAGAGCATCAAGGCTGCTGCC
GAAGAGGTGGAGCGCATCACCAATGGCAAGCTCGATATTCTGGTGAACAACGCGTGAGCAAGCAATCTCTCTATCCCACC
CCCTTTTTCCCTTTTCTTTGCCCTTCCCTCGCTGACAGTCCAGAGGCATCACCTACCCAGTTCCCCTATCCGACGTGGCG
CTGCCGCGACTGCGCAGCCTCTTCGAGACCAACGTGTTCGCCGTTGTCGCCCTGACCAACGCGCTGCTACCGCAGCTGAT
CGCCGGACGCGGACTCGTCGTCAACATCTCGTCCGCAGCCGAGGGCCTCGCATTCCCGTTCAAGGGTGCCTATGCCATGA
CCAAGGCTGCACTGGCCTCGTACAGCCGCACGCTGTCGGTCGAACTGGCCGAACTGGGCGTGCGTGTGCTCAATGTCACC
ACCGCCTTTGTGCAGTCACAGCTGGGCAAGCGCGCACCACCGGAGCCCTGGCCGGCCGACAGCCTGTTTGACAGCATGCG
CCAGGTCGGCCAGCGCGCCGGCAGCGGCACACGCATGTTGCCCGCCGACTATGCCCGCCGCGTTGTCGCCGAGGCCCTGC
GCGGGCCCGGCTGGGAATTCGGCCCTTGGCGCTTCTTCGGCACCCGCGAGACCATCATGCTCGGTACCCTCAGCACGCCC
ATGTGGCTGCTCGGCTTTCTCGGCAGCAACTGGGCCCGTTTTGCCATGTTGCGCATGTGGAAGTTCCGCGTGCTGCGCGA
GGCTTTGTTGAAGGACAAGTCTGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62