GenePrediction:GLEAN_293 Details

Name: GLEAN_293
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:836975..838733 (+ strand)
Length: 1759
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:836975..836986 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_167:837144..837539 (+ strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_167:837608..838087 (+ strand)
Length: 480
Type: CDS
Source: GLEAN
Position: GCSC_167:838164..838320 (+ strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_167:838399..838733 (+ strand)
Length: 335
>GLEAN_293 class=GenePrediction position=GCSC_167:836975..838733 (+ strand)
ATGTTTTCTCAGGTAAGTCGAGCGACGCAATGCACGAAGAGATATGAACCCAGATGCTACAACGTCCTATATTTCGTAAC
CTTTTATGCTCTCACATGCAAACCTCTTGAGGCTATGCTTTACTTAGCTCTCAGTGCTTTTGCTGTAGGCTGCTAACTAT
TTGGTGCAGAAAAAACCGTATACTGCAGTCACTGCCACCATCGAGCGCCTCACGAGCGAGTCATATGAGGAAGATGACCT
AAGTGGAATCCCCGACCTTGTTGAAGTGATTAAATTACAGTCGACTGGACCGGCCGAGGCTGCTCGTGCCATTCGAAAGA
AGCTCAAGTATGGAAGTGTGCATCGGCAGCTGAGAGCTCTGGCACTGCTGGATGGCCTGATTCAAAATGCAGGCGCTCGC
TTCCAGCACGCCTTTGCAGACGAGCCACTTCTGGAACGTCTCCGCGTCTGCGGTACCTCGGACTTGTCGGACCCTGATGT
CAAGAAGAAGTGTCTGGAATTGTTCCGCAACTGGACTCAATACAAAAACACACCAGGCCTCGAACGTGTTGCCCGCTTGT
ACAAGGTAATATACCACTGCTATAAACCTCTAGACATGCAAGAAATTGGAGACTGACATCGGAAACTCTGTAGGAACTTC
CGCAGCGCAAGCAAGTAGTGACCCAGGCACGATCCAAGGTGGTGCAGGAGACGGAAAACCCCTTTGACGATGACGAAGAT
GATGAAAAGCCGGTTTCAGAACCGGCGCCTGCGGCGGGTCCTTCTTTGGCCACCAGCTCTACTCAAGCTTCATCTTCGTC
AGGCTTCCGTCCGAATACAGAGACACAGCCGACTGGCCTTATAGAGTCATTCAGCTTCCTATCCTCGACACAGGACAAGG
ACAAGAGCAAGAAGAAGAAGGACAAAGCCAGCAAGAAGGGTCGCAAGCCGTTTAATCTGGAAGCCGAAAAAGGCTTGATG
AAGTCTACCATTGCTGATGCATCTATTGCGGCGATCGACCTCATGAACACACTACAGAGTATCAACCGCGAGCAGGAGCG
GATATCTGAGAACTCGACTGCTCTTCAGCGATTTGAAGCCGCCAAACTTCTCCGGAGAAAAGTTCTTAGATATGTGAGTG
CCCCGTAATGCCTACGGTCTCCGTATTGACAACGGGCTACAAGAGTCAGAGACTGACAGAATGCTTCAGATCTATCTTGT
AGACTCGGAGGAATACCTCGGCAGTCTGCTGCACGCCAACGACGAACTTGTTACTGCACTTATGACGTTCGAGCAGCTGG
ACCGCTCTATCGACGCAGACAGTGACTCGGATGATGACCTGGCTGAGCAAGCCCATCGATACCGGAGTACGTAAACCTCA
ACCGTGCTTCAATTCCATTACTTTACCGTCTGTATTGGTCGAGCTGACAACCGCATCTGTACAGTGATTGTCGAAAAAGG
CAAAGAACCGGCATCCCCAACCTCTGCATCTGCCGTGCCTGAACTGGGAGGCTTGAGTATTGATATTGAAAAGCCAAGCA
CGGCCCCATCCGTACCAAAGCCACCCTCCCGTCCTCTAGCTCCCCCTAGGCCCTCGGCCAAGTCGAAACCACAGATGCCG
CTGTTCATTGGCCAGCTTCCACCACCAAGAAGAGCACCAAGGGATGACTCTGACGGTGGTGAGAGCTACGAGGATGCAGA
TGATGACGAGAATGACCCCTTTGCAGACCGGCATGAGGTAGGGACCCCTGCGGTGGAAACGGAAGAACCAAGGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62