GenePrediction:GLEAN_2941 Details

Name: GLEAN_2941
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4354898..4355551 (+ strand)
Length: 654
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4354898..4355215 (+ strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_140:4355342..4355551 (+ strand)
Length: 210
>GLEAN_2941 class=GenePrediction position=GCSC_140:4354898..4355551 (+ strand)
ATGGTAGAAACCCTCTGTGACGATGATCTAGATGTGACTGTACACTTTTCACATTTTTGCGTCACCAAGATTGCGCTCTC
GGAGGACTCGAACGCCCAGTTCACGCAAAGTGCGATGCTCGAGGCCGCACAGCTATTAGCGGATGCTCATGTAGACATTA
TTGGACGGAGTGGTACGTCAGCGACATGGCTTGGATTCTCCACGGACGACGCACTCTGTGCCACCATAGAGAGTGTTACC
GGAATTCCGGCAATGACCTCTATCATCGCCTCGAATGAACTGCTCAAGCGTCGATCAATCTTCACGGATGTTGGTCTGGT
CAGCCCCTATACTGCTGATGTGAAATGGCCATCAAGGCAAGCTATCGGGGAATCGGCATTGAGATTTCAGACGAACGGAC
TTGCTGTGCCGGTCTTTTCGTAAACATCGATTAGCACCGTGCAGGAAATACAGCTTGACGCCATGGTTGCTCAAGTAGTC
AGAAATGGGGCAACGACGGTCCTTGTGGTGCGCACCATCTTACGTGCTGCCCAGCGGGCAAAATACTGGGAGTCGTCGCA
TGGGATACAGGTCCTGGACTCGGTCGCTACAGTGGTTTTCCGAATGATGCAGAAACTCGGCATCAGCACCAACTCAGCCT
TTCTGGATCGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62