GenePrediction:GLEAN_2942 Details

Name: GLEAN_2942
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4357653..4359322 (+ strand)
Length: 1670
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4357653..4357667 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_140:4357801..4357822 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:4357894..4358492 (+ strand)
Length: 599
Type: CDS
Source: GLEAN
Position: GCSC_140:4358561..4359322 (+ strand)
Length: 762
>GLEAN_2942 class=GenePrediction position=GCSC_140:4357653..4359322 (+ strand)
ATGTCGAACATGCAAGTAAGTCAGCAATATGGTGTCAAACCAGAGAACAGCCCTTTCTGACAGACGCCGCAGAAGTTCGT
AAGGACCTCCTTAAGGCCCCGTCAGTAGTATTCTCTATAACGGCAATCGTATAGCTCGTAAAGTAAAGTGTGACGAGGCC
CAGCCGGCATGTATTCGATGTGAGAGTCCCCTGTCTTCCTGGGAAGCTATGTGTTGGCAGGCTGGCAAGCTGACCTGACA
GGCACCTCGACCGGACGGTTCTGCGACGGCTTCGACTTTGTGCCGGAGGGGGCCTCGGCTGTCCAGAGCCCATCCACGGC
CCTGACATATGCGTCGTCTCCGTTTGCCGACCCACTTGAAGCACGCTCTCTGCAGTACTTTGCCGAGCGCACCATCGGCG
AGTTAGAGACATTTTTTCCGGACTCGCTCTGGAGCAGCCACGTGCTGCAACTGGCATTATCTCAGGAGGGCATACGACAT
GCACTAATGTCGCTTGCCGCCCATCACGAACGCTTTGCCAACCCTTGTGCCGCCGGCGAGCCCGAGTTTGCCTTTAAGCA
GCACAGCCTCGCCGTGCGGTCCCTATTGGCTGAAGACGACCCCTCGACGGCAACAGAAACGCACCTGGTATCGTGCCTGA
TATTTCTCTGTATCGAGGCACTCCAGAACGAGTACCGATCTGCCATCCGGCTGTTTAAGCATGGTGTCAGCATGGTCAAG
GAGCTGCGCCGACGGGCTGACGCGGCCGAAATGATGCAGTCTGGAGCCAATCCGATTTCGGACGGTATTGTCTCCACAAT
CGAGGCGTTCATCAACCGATTTGCCGTTCAGGCTGCGCTGGTATGTATTTCGCTCGGCTCTGCGAATCATATGCGGATGC
GGATGCTGATGCTGACACTGATGGAAAGCTCGCCGGAGATGTGGACCCCAGTCTGGTTGTCGGTGATCATCCTAGCTATG
ACAGCGTCGTCGCTGATTCGGCTTCGTTTGCATCTATGTCAGAGGCGCGGCAAATGATTCTCGATATAGCCGTCGACATT
ATCGCGCAGCCTCCTGGTAGCGGCAGTAGCGAGGAGATGGCATTGGTACATGTGACGTACAACCGCTGGTGTGAGAAATT
CGACAAGCTTGTTAGTGAGCGCTCCAACTCGCTGCCTGCCAAAGGCATCGCGCTCTTGGAACTGCACAAACGGTATCTGG
GCATTCATCTTGCCGCTCCTGACATCACCATCGAAGACCCTCCTAGGTGGGACGAAGACACGGCTGCATACGAAGAGCTG
ATGACGTTTGCCGAGACAGCCGTGGGTCCAGATATCAGTGTGGAAGGACCGACGACGACAACGGCTACGACAAATGGGAT
GCCAAAGTTTCACATGGACCTTGGAGTTCTTCCAATTTTGTTCTCCACGGTGCTGCGGTGCCGTGATGCGGGAGTTCGGC
GGCGGGCGATCTCATTGATGAAATCCAAAAGACTGCAAGAGGGAATCTGGCCAAGTACTACAACCTCTCAGGTGGCCGAG
AGAATCGTGTCGCTTGAACAGAGTGGCGATGATTCCGGCCCGCTACAGAGAGTGCAGTCCGTCGCCATAGCGTTTGGCTC
GGAGCAGAAGGTCGTGACTATAAGGTATGGGTTGAGAAACTCTGTATTCGAAGAGGTGCTTGGCTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62