GenePrediction:GLEAN_294 Details

Name: GLEAN_294
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:842930..847038 (+ strand)
Length: 4109
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:842930..843135 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_167:843203..845451 (+ strand)
Length: 2249
Type: CDS
Source: GLEAN
Position: GCSC_167:845507..847038 (+ strand)
Length: 1532
>GLEAN_294 class=GenePrediction position=GCSC_167:842930..847038 (+ strand)
ATGGATCTAACCGCCCGACCGCCTGCGGGCCATGGTGCTGATGCCGAGATGCTGGCGGGACTCTGGCAACATGCGCCATT
TCCGCGGCTGCCGCTGGACGCTCCGGCCGAGCTCCGGGAGCTCGTGGCAGACGTCGAGAATCCTCGCCGTGTCTATGCTA
TTCATCGGGCCAGTCGTCGTCACAACTTCCAGCTGACGGTGCAGAAGTGCGTCGCTCTTTTCCCGTCTTACGTTCTGTTC
GCTTGGTAGGCCTACTGACTTGCCGTGTTTCAGATACATCGTTCAGCTATGCGAAGGCTGTGGTGCCAGCGAGTGCCACA
ATCCCACCTGCTTCACCTGCCGGAAGCGCATCGCCGGCCAGGCCCCCCTCCGTCGATACAACGCCACGAGCGCCCGCACG
CTTGCCGTTCATCTTGCGAGTCAGGAAAATCCCGAAGTCGGCCTATGCGCCTCGCTCAGGCTTCCGAAAACCGCCCCGGC
AGCAGTCCGGTCTCTGCGTTTTACGCCCAAATATCCCCCAATGACCCGTGGAGACGGCGTATCGAGCAGTTCCAAAACGA
CATTGGCTCGTGCCGGGTCACCGAAAGACCGGAAGAGTGCAACAAAGCACGGGCACGCTGTGTATGCAGGATCTAAGGAC
GGTGGGACACAGTCGGAAAAGTCGACTCGCTCAAAAGCAGACACTGCCTCTGAGGGCCTGCAGGAGGCCCCGAAGTTCAT
AATTGTGGACAAGCCTGCCAGCAAAGACTACCGGTCTTTTGCCGCGAATATGTTCGGCACCGTAGCGTTCAAGATGCTCG
AGTGGCTGACGCCTGCAGCTATCGAAAACATGACCGAGAAAGCAGAGAAGCTGCAGGCTGGCTTTCCGGCATCTGACGAG
GGGAAGATCAGGGCCCAGGAGGAAAGGCCCAGACATGATGCGACAGCGAAAGAAGCAAAGGATATGACGGGCTCCGAGTC
AGTCGATGCGACAGGTAGACATGACTCTGGGGCTGCAGAATTGGCTGGTTTAGACAGTCGTGCTACCTCAAACGGAAAGT
CGCGACAGACGACATCGCCGACAAATACTCGGCGAAACTCCAACGCGCGACTTCGCACGCAGTCGACGAAGCCGCAACGC
AAATTGTCTGTCGACGCCTTCCCCCCGGAGTCCTCTAACGACGAGCTGCTACCCAACTTGCGCTCCCCTCTAATACCCAG
CATACAGACGGACGGTATGAATCACAGGACGCCGCCGACCAAGTCGCTTAAGACGCCGACGCCGGCGATTCCCCGCCCAA
TCTCCCAGCTATCTGGGGCTGCATACTTTGAGGGTGTCCCTTTGGAGAAGATGCCACCGATTATGACCGCTGAGATCAGG
CCGCAAGTTGGACGCAACCAGGCTGATGGGTCCCAAGGCAGCGGGAGCGAGAGCAGTTTGGAGCAGCTTGGATCACGGTC
CTCTCGGTCGCCATCTTCGGATCGGTCTGATGCAAATCAGTCTTCTGTACTGTTGGACGCCGACCTTCTGGACACCACAT
TCGATACGTTTCTTCCACAAACACTTACGCGATTGGATACCGAGACGATCGACTTTGTGTGCGACGTGCTTCAAGACGAC
CACACAGCCGAACAGCACCTGCTCGAGCCCGCGACAGTTGCAAAGTTCCACACAAGGGTCAGCGGCCAACCCCGACCTCT
GCGGCGGAAGGAAAAGTCGCTGGTCCATGGCCAGTCGGTGCGGCTTCGAGAAGGAGAGGAATGGCGCCTGTTTGCCGAGC
AGAGCTTCTTCTACGTCCTGAGTGATCCCCATACGCTTCTGAGCTCGTTTACGAAACATGGCCAGCTCTACGACACACAG
ACGCTCTGGTACTGCATGCTGCGCATGACTCGTGTTGCCCCAAGTCTAGTTTTTCACAGCCTGTGGGTGGCTGCCGAGAT
GCTGTTTGCGCCCCCTCAAGCGTTGCAGGCACTCTGCTCGCCGACAGTCCGCCTCTTCCCCCAGGCGCGCAAGTTTCTGA
CAAATGCGGAGGCCGGCATGCTTGTCTCTATCTGCCTGCACGCTCTTGTGGCAGCTGCTCCGCCGGTCGACAGCGCCAGA
AAGCTCTACGACATGTCCCGCATCCGGTCCCAGGGTTTGAGCCTCGCTGTCAGCAACTCCATTGCGCGACAACCTGCCGA
ACTATGCCTCCAGTATGACGATGCCTTTTCGAACCCGCTGGCGCTGCGGCTGGCCAGACGGCTGCTGACGGCCATCACAA
CCCGGCGGATTTTCGACGAGCTGATGGAGTACGACGTGGGCCGTAATAGCAGTAGCGAGCTCGACGTCCTGGACCATCTC
TTTGCACAGCTCGACTTCTTGAACATGGACGCTGCATACATTCTCGACTTCACCGTTGCTGACCGGACCCTCCATGAGAC
GAGAATGCCGACGTTGCTTCTCGACTGGGCAAGAGCAGTCATGCTGCATGATTGGGACGGACGGCCGGATGTTTCGGGAG
ACAGTCCGTTCGGTGGTGCACTCGCACTCATCAAGGCCATCTGTAAGTGGCCTTCTCTGTTCGCTATCTCTGTAAAATGC
TGACTAATACGCAACAGTTGAGCGACGACAAGCCCTCCTGGTTGGGGATGCACAGTTCCGGTCCGAGTTCTTTGCCGAGC
GCCTAGACGAGGTAGAGACGCCGCTGTCCTGGCTCACTTTCAACTCGACCAAACAGAGGCTGCATATCCTTGACTTCCCC
TATATCTTTAGCCCGGACACGCTCGTGTCGTACTTTCGGGCGATCAACTTCTCTCGGATGAGCCGGTCGTTTGAGGAGTC
CAGCTCGCTGCAGAACCGTATGGATGCGATAGTGTCGCCCAGCAGCCTAGTCATCAACCCTCACCACAAATCGATCCTGC
AGGGACTCTTGCAGACGGCGTCGGCCAAGTATCTTATCCTCGACATCGGGCGCACGTCGGTGCTGCAGGACGCATTCGAC
CAGCTGTGGCGGCGGGAGGAACGGGAGCTGCTGCGGCCACTCAAGATTCATCTCGGCGAAGAAGGCGGCGAGGAGGGACT
GGATTCGGGCGGTGTGCAGCAAGAGTTCTTCCGGATGGCCATTGCCGAAGCTCTCGACCCGGCGTACGGCGCCTTTACGG
TAGACAGCCGCACGCGCATGGCCTGGTTCAGTCCGACGACCCTGGAGGAGGAGTGGAAGTTTGAGCTGGTCGGGATTCTG
GTGTCGCTCGCGCTCTACAACGGCGTGTCGCTCCCGGTGACCTTTCCGAAGGCGCTATACCGCAAGCTATTGGGCGAGCC
GGTGACGGAGCTGCACCACATCTCAGACGGCTGGCCGGACCTGGCCAACGGATTGACGGCGCTGCTGGAGTGGAACGAGC
AGGACGGGGCGGTGGAGGACATCTTTGTGCGGACGTACGAGTTCTCTGTCGACATGTTTGGCCAGCCAATCTCCCGGGTG
ATGGACGCGTCGGGATCGTGGCCCAAGATCCGCGAGAATGTCACAGGCACGCGAGCCAGGAGCAAGAAGAACAAGGAGGC
AAGCGACAGTGGTTATGGGCCGACAGCCTCGACTCTGCTGGAGGCGAACCCGGGGGACGAGGCGCCGATGGTGACAAACG
CGAACCGCAACGCATACGTGACGGACTACATCCACTACCTGACGGATGTGTCGGTGCGGCGGCAGTTTGAGGGGTTCTCG
CGGGGCTTCCGGGCGTGTCTGCACGCCAAGTCGCTGCGGCTGCTTACGCCAGCGCTGCTGCAGTCGATGGTGGAGGGCGA
GCAAGAGATTGACGTGTCGGAGCTGCGGCGCCAGGCGCGCTACGTCGGCTGGGATGCGAGCCATCGGACGGTGCGGGATT
TTTGGAGCGTGGTATCGCGGTACGACGACGTGATGAAGCGCAAGCTGCTCGAGTTTGTCACGGCGAGCGACCGGGTGCCG
GTGGGCGGCATAAAAAACCTGCACTTTGTCATCCAGCGCAACGGCGAGGAGTCAGGAACCGGCGGACATCTGCCGACGGC
CTACACCTGCTACGGCATCCTGCTGCTGCCCGTATACCGGGATCGTGCCGTGTTGCAGGAGCGGCTGGCGATGGCGCTGG
AGAACGCGCAGGGCTTTGGATTTGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62