GenePrediction:GLEAN_2954 Details

Name: GLEAN_2954
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:68410..70041 (+ strand)
Length: 1632
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:68410..68711 (+ strand)
Length: 302
Type: CDS
Source: GLEAN
Position: GCSC_124:68784..70041 (+ strand)
Length: 1258
>GLEAN_2954 class=GenePrediction position=GCSC_124:68410..70041 (+ strand)
ATGGAGCTCATCTACTACGCTATACTCGCTGGCGTATTGCTGCCGGCCTGGTTCATGTCCTACTGGATTGTGCCCTACTT
CACCACCTATGCCCACCTCAAGCACATCCCGGGCCCGTTCGTCGCAAAGTTCAGCAACATCTGGCTGGCCACTGGAGCCC
ATGGCGGCCAGAAGTTCGTCTGGGTCGACTGGGCACATCGCAAGTACGGCAAGGTCGTTCGTGTCGGCTTCAACCATGTG
TCCATTGCCACACCAGAGGGCCTACGCATCGTGTATGCCCATGGAAACGGCTTCCTGAAGGAGTAAGTGTCGGACGGTCC
CAGTCTGGAGATGCTCTCGGGAGAAGCAACGCTTGCTGACAGGCTGTCCACCAGCCACTTCTACAACGCGTTTGTCTCCG
GCGTGCCGGGCGTCTTCAACGTGCGCGACCGCACCGAGCACGGTCGCAAGCGCAAAATCGTTGCCCACGCTTTCTCGCCC
GGAGCTGTTCAGGATTTTGAGCCGCATATGACCAACAACCTGGAGCGCTGGGTAGGCCAGCTCGACAACATCGCATCACA
CCCCGACTCACCCGACGGATTTGCCAGCATTAACATGATGCCATGGTGCACCTTTGTGGCCTTTGACATCATTGGCGACC
TCGCCTTCGGTGCGCCCTTTGGCATGGTCATGCGTGGCCGCGACGAATGCGAGTCCACTATGCCCGGCAAGGCCACAATC
TATGTTCCCGGTGCCGAGACGCTCAACCGCCGTGGCGAGGTCAGCTCAACCCTGGGTCTGCTGCCGCAAATCCGGCCTTT
TGCCAAGTACCTGCCCGACCCCTTCTTCTCGCGGGGCCTCCAGTCGGTGGCCAACCTCCACGGAATCGCCGTTGCCGCCG
TCGACAAGCGTCTAGGCTCCCAAGACGCTGCCGAGAAGGGTGGTATTGTCGCCCAGGGCCGCCACGACATCCTCGAGATG
CTGTGCCGCGCTAAAGACGGCAGCGGCCAGCCCATCAAGCGCGACGAGCTTATCTCCGAAGCCCTGACGCAGTTGATCGC
CGGCAGCGACACCGTCTCCAATACTGCCTGTGCCGTTACCTACTGGATCCTTCACGGCGAACGGGCTAAGCCCGGCTCTG
TTCTGCCCCGCCTGCAGGCCGAGCTTGACGCCGCCGTTCCTGCCGGCACCGCCGTCGCCTCTCACGCTATGGTCAAAAAC
CTCAAATTCCTCCGCCAGTGCATCGATGAGGGCATGCGTCTGCACTCCACCTCCGCCCTCGGCCTGCCGCGCATCGTCAC
CGCACCCGAGGGAATCGACTGTGAGAACGAGCACTTCCCCGTCGGCACCGTCCTGTCCGTTCCCAGCTTCTCCATCCACC
ACGATGCCGACATCTGGGGCCCCGATGTCGAGGAGTTCCGTCCCGACCGCTGGCTGGATCTCACCCCGCGTCAGCGCATC
TGCTTCAACCCCTTCTCCTTTGGGCCCCGTGCCTGCGTCGGCCAGAACGTCGCACACATGGAGCTGGCCCTGATAATCGG
CACTGCCTTCCGCCGCTACGACTTTAACCTGTATCAGCCCCAGCTGATGTCGCATGAGGGCTTCAGCAAAAAACCTGTCG
ATTGTTGGGTCGGTATTCGCCGACGTAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62