GenePrediction:GLEAN_2956 Details

Name: GLEAN_2956
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:98900..100724 (+ strand)
Length: 1825
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:98900..99001 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_124:99049..100231 (+ strand)
Length: 1183
Type: CDS
Source: GLEAN
Position: GCSC_124:100314..100551 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_124:100712..100724 (+ strand)
Length: 13
>GLEAN_2956 class=GenePrediction position=GCSC_124:98900..100724 (+ strand)
ATGGAATACGAAGAGAGCACCGACTCGGCCCCCGGCAGCCATCTGGATTCCCGCCATGGCGCGAACAGGCCGCTGGCCGT
GATTGCGGCCACTGGGATTGGGGTGAGTGCATGGCGTCGTCGGCTGAAGCTACTCTCGCTGACTGTCAGATCTTTCTCTC
CGCTGCCGACTCCACCATTGTCATCGCCTCGTACGGCCGCATCGGCAACGATCTAGATGCCCTTGGTGAGGCCAATTGGG
TCGCCCTGGGCTACTACCTAACCCTCAGCACCTTCCAGCCGCTGTACGGCCGCCTGAGTGACATCTTTGGCGTCCGCCGC
TGTCTGCTCTTCGCCTATGCTACCTTCGGCCTCGGCTCTCTCCTCTGCGGCCTCTCCGGCTCCATCTGGCAGCTCTTTGC
CGCTCGTCTCTGCCAGGGCATCGGCGGTGGTGGCATGACCACGCTTGTCAGCATCCTGCTTACCGACATTGTCCCACTCG
AAGACCGCGGCCTCTGGCAGGGCCTCTTAAACATTGTCTATGCTGCTGGAGCCGGAGCTGGAGGTCCGATCGGTGGCGCA
TTTGCCGAGTCGACATGGGGCTGGCGGGTCTCCTTCTTTGTGCAGATCCCCTTTAGCATCCTCGCATTCGTTGCTGTCAG
CCTAGTTCTGCCCTCGTCTGCCGGTTATGCCAGGACATCTGCATTTCCTACGACCGTTGAGCCTCACGAATTTCGGGAAT
CCATCGATTTACACCAACCACATAATTCTCCTACGTCTCCCCTCACTCGCATCGACTTTCCTGGTGCCTTCTCCCTCTTC
GCTGCTATCCTCTCTCTCCTCGTTGCCCTCGACCGTGGAAGCAATGTCGGTTGGGCCAGTCCATTCTGCTGGGCTCCTCT
TGTCGCCTTCCCCCTCTTCGCAGCGATCTTTCTCCACATCGAGACCGCCGTGGCCGTTGAGCCGTTCACCCCCCCTGCCT
GGGTCGCCCGCCGGTCTCGTCTACCTGCCTACCTCTCCAGCCTCTTCGCCTTTGGTGCCAATGTAGCTCATGCCTACTCC
CTCGCCATGATCTACCAGGTAACCCGTGATGCATCTCCCCTCCAAGCCTCCCTTTTGCTCCTGCCTGGAACAATCGCGGA
GGTCATTGGGACGCTCTTGTCCGGATTTCTGCTCAAGCGCTCCTTTAATTTGTACCGCCTCAACATATTCGGTTATGCCA
TGGTTGCCCTCGGGAACGTCTCCATTGCCAATGGTGCTCGGTCTTCTACTCGCCTGGCCGTTCTCCTCTTCGGAAACGCT
ATGGCGGGCCTTGGAAACGGGTTTGGAATTATTACTTCTCTTGTCAATCCCGGTGTGTTTCTATCCGTTTTTTTCAATCA
TGATTCATAATCAGAGATGCCTCTTCACTACAACTCTCACCTAACCTCCTCTAGTCGCTTCTGCCAAGAAGGAGGAACAG
GCAATAGCTGTTTCGTCTTGCTACCTCTTCCGCGTCATCGGATCAATCACCGGTATTTCCATCACCTCCGCCTTGACTCG
GAAATCTCTTGGTGCTATCCTGCAATCCACGCTCGATGCCGACGATGTCAGCTACATCCTCTCGCAGACTCGGCACAGCC
TCGACTTTCTCTCCGATCTGGACCCAACCCTTGCGGCGATCGTTGCGACAGCGTACGGCCGAGCTCTTGGCTTAGGCCTT
TGGCTTCCAGCAGCTTATGCTGTTTGTGCTGTCATCAGTAGTATATTTCTGCGAACACAGAGAACCCAATTGTAGCGTTG
GAATCATGAGCTGGAAGACAATTATAGACACAAAACTATCATCTTATCACAGTTCTCGCAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62