GenePrediction:GLEAN_2957 Details

Name: GLEAN_2957
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:104696..107495 (+ strand)
Length: 2800
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:104696..104931 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_124:105306..105468 (+ strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_124:105526..105564 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_124:105614..105729 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_124:105786..105894 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_124:105954..106182 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_124:106237..107495 (+ strand)
Length: 1259
>GLEAN_2957 class=GenePrediction position=GCSC_124:104696..107495 (+ strand)
ATGCTCCGGCATGCGGGGTCTCCACAAAGTCGGCCAGCTAGGCCGGAAGCCACGCTCGAAAACGTTGCATCGTCACTTGA
CTCTTTCGGCCCTATCATTGCTGCAGTGCTCCTCGTGGCCTGTGCGCTGGCGCTGCCGTGTGCACACAGAGCATACCCGA
AGAGGAAGCGCACCGCAACGCTGTACTACGACAGGCAGGTCGGCCGGAGATGGTCACCAACACAAGCCAAGTTTCGGTGG
CACTCCGGAGACGGAAGACGCTTTTCGGCCCACCGTCATGAGAGGCCGACGAAGATCGTGGTGGCCAGACGCATGTAGCA
GTCGAGCTGCCAAATGCAGTTAGCGGTACAAACGCCGATCAAACAACTTCGCCCACTGGTCATGCTGCCTTGCCGAGCAT
TACCTGGGGGCCGAACCAAGTCGGTGAACCAAGGAGCCGAAGTATCTCCACTTTCCCCGCGAGATCTCCAACCGTGGACG
CTGCTATCGAAGGGCTGGCTTAAAAGGTCTTGGCTGTCATTCCTGCATGTCGTGCATCGTCTATGGAAGGCAGATGTCAG
CTGTCTGCTGCCTATTGTAACATATGCACTATGTATCACACTCACTATAGCCACATTAGATGGTCTTGCATCGCCTTGTG
GGCCCTCCTCGGCCAAGTCGCCCTAGCACTGACTCCAGTACAGTGGCGCGGCCAGTCTATTTACTTTCTTCTAACAGACC
GGTTTGCCCGCACCGACAACAGCACCACTGCTGCATGCGACACCAGCAAGAGGGTTAGCCTCTGGTTCTGTCTTAGTTTG
TACTTAGAGTCGATCGGCTAAAGCTTACAGGCGTACTGCGGTGGAAGCTGGCAGGGAATTATCAACCAGGTAAGTGCGAT
TAGGCGCACTTCTGGCACTTGCTTATACTTGTCCATAGCTGGATTACATTCAAGGAATGGGCTTCACAGCCGTATGGATC
ACACCAGTGACGGGGCAATTCTACGAAAGCACATCTGATGGGACGTCGTATCACGGGTACTGGCAACAGGACATGTCAGT
TGGAGAACCTGCCCTTCTCTTGATGTGGCTCTTTGTTGACACTCTGACAGATATGATTTAAACCCCAACTATGGAACCGG
AAGTGACCTCCTGAAGTTATCCAAAGCGCTGCACGACCGTGGAATGTACCTCATGGTCGATGTGGTGGCGAACCACATGG
TGAGCTAGAGGGGGCGTAAATACAGTCTTGACGGGACCCACGTACTGACAGACACCAGGGCTACGATGGCAGTGACTCAT
CCGTGGACTACAGCGTGTTCGACCCGTTCAACGCCGCGAGCTACTTCCACCCTTACTGCCTCATCTCCAACTATGAAAAC
CAAACAGAGGTAGAGGACTGCTGGCTTGGAGACTCATCTGTGTCTCTGCCGGACCTCAACACATCCCAAACAGCTGTTCA
AGACATATGGTACAGCTGGGTGTCATCTCTGGTAACCAACTACTCGGGTAAGTACTCACCTCTCTACTGTCTCACAAGCC
TGCTTTTAACAAACTATCCAGTTGATGGTCTGCGTATAGACACCGTAAAGCATGTGCAGAAGTCATTTTGGTCTGGTTTT
AACGATGCTGCCGGGGTCTATTGCGTTGGCGAGGTCTTCGACGGCGACCCGGACTATGCCTGTGCTTACCAGAAGTACCT
GGACGGTCTGTTGAACTACCCGATCTACTATCCGCTTATAAGCGTCTTTAGCGGTTCCGGCACCTCTTCTAGTATCAGTA
GCCTCTACAGCATGGTAGCCTCAGTGGCGGCCGATTGCACTGACGCTACGCTATTAGGCACTTTCGTCGAAAACCACGAC
AACCCTCGGTTTGCCAGCTACACGACCGATTATTCCCTGGCCAAAAATGCGCTAGTATTTCTCTTTCTCAGCGACGGCAT
CCCCATCGTCTATGCTGGCCAGGAGCAGCACTACAGCGGCGGTGCAGACCCGGCCAATCGTGAGGCGACTTGGCTTTCCG
GATATAACATCACGGCCGAGCTTTATGTCTTCCTCCGCACTACCAACAAGATTCGCAGCCTTGTTGCCACCCGTGACTCT
GCCTGGACCACCGCGCCAAATACCCCCTTCTACCAGGATACCACCACGCTCGCCATGCGAAAAGGATCCGTTTCTGGAAG
TCAGGTTATTACTATTGTCAGCAACCTCGGTCAGGGTGGCAGTAGCTACAGTCTCACCCTCAACAGCACTGAAACTGGTT
ACACTGCTGATGCCTCCTTCGTCGAGGCATATTCATGCGCAAGCCTCGCCGCAGATTCAGCCGGCAATGTAGCTGTTCCG
ATGTCTTCGGGCCTTCCCAGAATCCTTGTCCCGGCTTCCTGGATCAGTGACAGCGGTCTGTGTGGCTCTTCTGTGTTGTC
TGCGACTGCTACCAATTCGGCTTCGACGAAAGCGTCCTCTGCAACATCCTCATCTTCCACTATCACCACCGCTTGTACAA
CAGCAACAGCCCTTCCCGTCATATTCAAGGAGACGGTGACCACCGTGTACGGTGAAAACATTTTCATCTCGGGATCTATC
TCCCAGCTTGGCAATTGGAATACAGCCAACGCTGTAGCCTTGTCCGCAGCCAATTACACCACCGCTAATCCGCTTTGGTT
CGTCACGGTCACGCTGCCCACTGGCACTGCATTTGAGTACAAGTACATGAAAGTAGGCAGTGGCGGTACTGTCATCTGGG
AGAGCGATCCCAACAGGTCGTTCACCGTGTCCTCTAGTTGTGTTGGGACAGTCGTTGTAGACAGCAGCACCTGGCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62