GenePrediction:GLEAN_2958 Details

Name: GLEAN_2958
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:147511..148662 (+ strand)
Length: 1152
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:147511..147545 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_124:147604..147706 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_124:147775..148662 (+ strand)
Length: 888
>GLEAN_2958 class=GenePrediction position=GCSC_124:147511..148662 (+ strand)
ATGTCGACTGACAAGATCACTTTTCTTACGAATTGGTATGCGATTGACGGTTGTCTTGGTTTCTCTCCAAAATCCAGTCC
CTGACACACACAGGCACGCCACGCCATACCACGCCCCTTTATTCCTAGCCCAGGCCAGGGGTTACTTTGACGATGAAGGC
ATTAAAGTTGCCATTGTCGAACCTAATGACCCGAGTGTGCGTGTTTCTGAACGAATAGCGGCAGGAAGGTTTGAGATCCG
CTAGCTAACTTGCGGGCCATTCAGGACGTGACGGAGATGATCGGCAGTGGCAAAATCGACCTCGGCTTCAAGGCGATGAT
CCACACGCTTGCAGCAAAGGCACACGGCTTTCCGGTTGTGTCGATCGGCAGTCTTCTCGATGAGCCATTCACGGGCGTGG
TCTACTTCAAGTCGTCGGGTATCACGACGGACTTCCGCAGTCTCCGGGGCAAGCGTATCGGCTACGTGGGCGAGTTCGGC
AAGATCCAGATCGACGAACTGACGAGCCACTATGGCATGAGCCCGTTGGACTACACGGCCGTGCGCTGTGGTATGAACGT
GTCGCGGGCAATCATTGACGGCAGCATCGACGCAGGCATTGGCTTGGAGAACGTACAGATGGTAGAGTTAGAGGAGTGGC
TGGCAAGCCAGGGCCGGGATCGGTCCGAGGTTACGATGCTGCGCATCGACGAGCTGGCCGAGCTGGGCTGCTGCTGTTTC
TGCTCCATCCTGTACATTGGCCATGAGCGGTTTGTGGCTGAGAATCCGGAAAAGGTGCGCGCCTTCTTGCGTGCCGTCAA
GCGGGCCACCGATTTTGTGCTCGCCGAACCCGAGACGGCCTGGAAAGAATACGTGGCCTGCAAGCCACCCATGGACACGG
CCCTCAACCGCAAGATCTTTGAGCGCAGCTACGCCTACCTGTCCAATGATCTCAAGAACGTCCAACGCGACTGGGCCAAG
GTTACTGCCTACGGCAAGCGTCTTGGCGTGCTCAACGCCGACTTTGCGCCCAACTACACTAATGATTTTCTCGAGTGGAC
CCTGGCGCCCGAGTCGGCCGACCCAACTGGCGACCAGAAGCGCATTGCTGTCTTGCAGAAGGACGTCGCCGTCCATGGCG
GTTTCCATCGTGTGGGCGAGCAGGTGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62