GenePrediction:GLEAN_2959 Details

Name: GLEAN_2959
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:151312..152977 (+ strand)
Length: 1666
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:151312..151411 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_124:151467..152176 (+ strand)
Length: 710
Type: CDS
Source: GLEAN
Position: GCSC_124:152246..152977 (+ strand)
Length: 732
>GLEAN_2959 class=GenePrediction position=GCSC_124:151312..152977 (+ strand)
ATGTCTGAAGGCAACATATCCGCCGAAAAAGGCCCAGAAACCATGATGACGGAAAAGGGGCAGCCAATGACGGCGGACGA
GCAGCGGCTGGCGCAGATGGGTGAGTGCCGACACGCTGCAGGCAGGTCGGGCAGACGGCGCTGACACTGGCGCAGGCCAC
CAGCAGGAGCTGAAGCGCCACTTCACGGTGATGTCGCTGATCGGCCTGGCCTCGACCACGACGATCTCGTGGACAGGCCT
GGGGCTGTCGATCGTGACGGAGATCGAGGCCGGCGGCCCGGGCGCGATCATCTACGGCTTCATATTGGTGACCATCCTGC
AATGCTTCCTGGGCGCGTCACTGGCCGAGTTTGTGTCCAGCTACCCGACCGAGGGCGGCATGTACCACTGGATCGCCGCG
ATTTCACCGCCTCGACCGCGCAGCTTCCTCAGCTTTATCACCGGCTGGCTGACCGTCTGTGGCTGGATCTTCACCACGGC
CTCGACCAACCTGATCTACGCCGAGACCCTGTCAGCCCTTATCGCCATCTTTCACCCCCACCTGAACATCCATGTGTGGC
AGACGTTTGTCATCTACCAGGGCCTCAACCTGCTCACCGCGGCCGTCGTGCTCTGGGGAAACCGCGCCATCCCGGCCCTC
AACAAGTTCTCGCTCTTCTACCTGCAGATCGGCTGGCTCGTCGTGCTTATCACCGTCGTGGCCTGCGCACCCTCGTATCG
CGACTCGGCCTTTGTCTTCCGGACCTGGGTCAACGGCACCGGCTGGAAGAACAATGCGATCTGCTTCATCACCGGCCTCG
TCAACCCGCTCTATAGCCTGGGCGGTCTTGATGGCGTCACTCACATCACGGAGGAGATGCCGAACGTGAGTCCCTGCTCC
CTGCTCCCTGCTCCCTGCTCCCTGCTCCCTGATACCTGATCCCTGACAAGATAGCCCTCGCGAAATGCCCCCCTGGCTAT
TGCCATCACCCTGACCATTGCCTTTGTCACCGGCCTGACCTACCTCATCGCCCTTATGTTTTGTGTGCAGGACTACGCCG
CCCTGGGCGACACCAACATGGTCCTGCCGCTGTCCGAGCTCTTCTACCAGGCCACCAGCTCACGTGGAGGCGCCTTTGGC
CTGACCTTTATCCTCTTCATCGCCCTCGGCCCCTGTGTCATCTCGTCCCAGCTGTCGACCAGCCGGGTCCTCTGGGCCTT
TTCCCGCGATCGCGCTATGCCCTACAGCGGCTGGTGGTCCCGCGTGTCTGTCCGTCACGGCGTCCCCTTCAACGCCCAAT
TGCTCGTCACTGCCGTCAATGCCGCTCTGGGCTGTATCTATCTTGGCTCTTCCACCGCCTTTAACAGCATGCTCGGCTCG
GCCGTCACCATCAACAACATCGCCTACCTCATCCCCATCCTCACCAATCTACTCACTGGCCGCCGCAACATGTACCGCGG
TGTCTTCTACATGGGCCGCTGGGGCTTCCTCGTCAATGGCATCACTGTTGCCTGGCTCATTTTCGCCATCGTCTTCTTCA
GCTTCCCCTACAGCATGCCCGCCACGACCGAGAACATGAACTACACCTGTGTCGTCGTGGGCGGGGTTCCCATCCTCATC
CTCGCCTGGTGGGTTTTCGGCAGCAAGCAGTACAAAGCCAAGATTGCCGTCGTTGCCGAACAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62