GenePrediction:GLEAN_295 Details

Name: GLEAN_295
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:850437..855217 (+ strand)
Length: 4781
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:850437..850475 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_167:850577..854671 (+ strand)
Length: 4095
Type: CDS
Source: GLEAN
Position: GCSC_167:854804..855217 (+ strand)
Length: 414
>GLEAN_295 class=GenePrediction position=GCSC_167:850437..855217 (+ strand)
ATGGATGTGGGCGAATATGAGACCAACACCTTTGTGGTCGTAAGCCTCTCCTTTCTTCTCAGCCCTTTTATCGGCAGACA
TTTCGTCCGGCCGTTTCAACCGTTGGTTGCTGACTCTTTTGGTTCTGCCCCCTTCTTCAGAGCAATATTGCGTCCATCGC
ATTTCGCGTCTATCGACCGGTCGTCTCGTCGTCACCGTCCGTCTATACCTCTTCCGCACCCGACGTTGAGAAGGCCCTCC
GCAACGATGGCCATCTCGTATTTGCCGACACGCGCCGACAGTGCATCTGGTGCTTCCGACTCATGCGCAGGGACGGTTCT
GCCATGGGATCGCCTGCAAAGTCCGAGCTCGCCACCACCATGGACGTTGGGCCATACAAGCTCATAGCTGTGGACGATGG
TGCGTTTGAGCCCATCAGCCTCCTGAAAGGTTCAGGAGGCCGACCTCACAACACGGTTGCGGTAAATACGCCCAACAGCT
CCTCGTCAGCCGTCTCTGCGTTTGATTCCACCGCCAGAAGTACCACGGGTCCGGCATCACAGTCAGCCGGCCTACTGCCA
CTGTCCCAAACGTCGAACATCAGTGCAGCTGCCTCGGACCTCGACACCCACAGCGTGCATTCGCAAGCAGCCACCCAGCC
CGACCAGAAGGGACTTCTGCCGGTTTCCGCCAAGGTAGTATACAACTTTTTTATCTCGGCCGTGCTTGCGGGCCTATCGT
CTGCCTATTGTGCAAAAGCACGGGCAATTGCTCTCAACAGCAGAACATTGTTGCTTCCTCCACTAGACCCTCTGTGGGAT
GGTGATGAGAGGAGCAGATCGGATGGCAGGGCATTGATCGCGACCCTTCGCGTTACCCTCACCACCGCCGGCTCTCTCCT
CTTGTACATCTCCCACACCGTTCTTCACGGCATGGGCTGTTCGGAGTGGGCCTGTTACGCTGGGATTCCGCCCGAGGGAT
GTGCTGTCCTCACTGCGCCCTGGGGAAAATTTGCAACGGTCCGAGGCGTCTACCAACCCCCTATGCCGGCTGGAATGGGG
CTGAAACGGAAGCAAGTTTCTGCTACTAGTGCTCCTCTTATGTGGAAGAACTTTGCTTCCAAGATGCTCGAAACCAGGGG
AATCTCGCCTGTAATTTTGCAGAACTCGTCTTGGTTGCGCATCGAATTTTCCCTGAGCGAAGAGGCACCGAATGATGTCC
CCGTTGTGATGCTATGGCCGTCCGTGCTCTGTTTCTGGAGTCTTGAGAGTCCCACCATAACGACTGCGCCATCCCAGAGA
CTAGATCCGCTGTCGGATATCAGGGAGGCCTACCTGGAGGAGACGAAGGAAGACGACCCTGCCGCCAAACTGGAAGATAT
GGATGTACCTATGGAAGACATTCAAATGGTTGCGGACGACAAGGGCAAGCGGTCGGTTGATCGACAACCCCTCTCTGGAG
CATTAAACACCTACAATAATGTCTCTATAAACAGTGCTGCCGCTGCCGCTGCCGCTGCTTCTGCGAACTCTGCTGCTCTG
GGGGCTATGTACCCAACGCCACCCGACGGTGTCTTAAATGCTGTGGGAGTGACGCCAACTTTTGACGGATCTACGTCAAG
TCCTGGGAATATGGCAAGTACCACTGCCCTAGCCTACCTAGACGGCAGCGTACCACAACTTGGTGCTCATGACGCGTCCT
TGGGCGACTTTTGGGATAGTGGAGAGCCAAAACGCGAAGAACAGGAAGAGCCATTTACCGCTGAACCCGATGCCCTTTTT
GGCGACATTGGCGCCGACATATTTGGAGACGACATCACTGATGCAGACTTCAACTTTTTCGACGAAAAGCCAGACAGAGC
CGATGCTGGCGCGTCCTCGGCGGTCTCTGACAAGATGGACATGGTCGAAAGCCCACAGCAAGCGTCGCCGCAGGCAGATC
AACAAGAGCCACCGCCCACTGAAGTACCTCAGATGGAAGAAGCGGTACCAGAAGAGAAGACACCCTCAAGGCCGGAGTCT
CCCGTCTTTGCGAAGCCCGAGCTGAAGAATGCGCGCAGCAACCTCCCGGGCGAGAGCCAGGCGGTCAAGCCGGCCTCGAA
TGCGCTCGATACAAAGCCGGTCGCGGCCGGAATCAAGCGTCCACCGAGTCCATTCGACGCCTTGACAGTATTTAAGCGCA
TCAGGGCAACGACGGAAGACAGCAAAAGCCAGAAAGTGGCGCCGAAGCAACCTTTCGCACGCCGAGGAAACTTGTTTCAA
GGGCTCAAGTTTAGCGACTTCATGATCGAGAACAACAAGAAGTACGAACAGAACGGAAAGTTCGGCTTTCGCTGGCCCCA
TCCCGAGACAGACATGTTATCCGACCTGTCGATGGTGACGTCGCCAACCGCTTTCCGACGACCGACTGGAAAGCAGGCCA
ACCCTTCGGATTCGTCTCCGGAATGGGCTGCCCTGATCACCAGCATCACTCGCGGACTGAAATCTAGCTCGTTACAGGCG
CAGAGCTTCTTGGACGATAGTGAGGACTCGTCGTCGGGCTCATCCGAGGATGCATTGTCTTCCGAGGACACGGACGACGA
TGACGAGGCGATGACTGTATCTTCGGCGCCGAGAAAGCCCGATATGAGTGAGAGCATGCCGACTCCCGAGGCAGCTGCTG
AATTGTCTAGAGCGTACAGCGAGGGTGTGTGGGACGTTCCTATTGCGCGGTATTTTGTCGATCCAATGCCGCCGCCAACA
GAGCTGGCCTACACGGACAATGATGTTATCGACGTGGCGCAAATCCTGACACAGCAGGTCACCCGGATGACGATCCGATC
TGGATTCGACGAGGACGAGGCACGGGACCTGCAGAAGACGAAGCTGCGCAATACGCTATTGCAGCGCATCCGCTATTCGG
TAGCGACGCTTCACGATGTCCTTCCTGCAGCGCTAGACGAGGCAACACGATGTTCACTCAAGCCATACCTGGACGTCCAA
GATATCCCGCTTCTTGTCCAGCCAGCTCGACCGCGACAGCCCCTTGGTCAGGAGCAACTGAGGCCGAACGTCTTCCACAT
TCCGACTCCGCATGTGGAGATTCAGCGGCACGAGTGGACGCTTTCGCTGGCCCCTACGGCCATTGATTTCTGGGACACGT
TGGCCCTTGAGCCGCTGCATGGCAGCAAAGAGATCCGGGCAGTCTGCGTGTACCCCGACTTCGATGGGCTGGACGACGAG
GTGAACGGATTTCTGAACCGGATGCGGATCGTGTACGAGTCGCTGCGGCTTGGCTCACACGACCGGCTTTCGGAAAAGTC
GGGCCATGTCACAGAGGGCATGGTTTCATTCGATGCCAGGGTGTCGTCGGGCACACCGTCTGGAATAGCAACACCGCGCC
CCGAGTTTGCGGGAGCGGACCAAGTGCACAGGCTCGCGCAGGCGCTGGCGGCAGAAGATGCGCAAGGCAAGAGCCTGGTG
GTGTACTTTGTGTACTGCGAGGAGGTGACGGGAGCGGTGGTGGATGCGTGTCTGGCATTCCAGCGGCTCTCACAGCTGTA
CGAGATGGCCGTGACAGGCTGCAGCAGCGAGCCGGGCGATCTTGTGCTGCAGCTGATCCCGACGAGTTTCCTTGCATCGC
CGACGGCACTGGTAGTTCCGACACCGGCAGATCTGCTACGGCTCTCGCTGGAGGTGTACGACCGCTGTGCGTCAGCGCGT
GGCCCGCGGCCAGCACCAGCTTTCCTGCTGGAGCAGCCGCCGCCGCGGATGCTGGATCTGCGACTGTCGGCCACACCATC
GGTGGATGTGCAGCGTGAGAACTCGTGCATCCATGTGGCCTATGCACGGAGCACGGACGAGCGATGGATGACGGCAGCGT
GGACGGACAGCAGCGGGTGGCGACAGTTCAGCTCGGCGTACTGGGTGGGACGGAAGGGAAGGCTGCCGGCGACGTCGTTT
GCAGCGGTGGCTCAAGAGATCTGGGACAATACATGCGCGATTGTGGGGAATCTGAAGGTGAACTGGCGGGCGATCATCAC
CAAGTGCGGTCCGATGGAGCCGGAGGAGATGGAGGCCTGGACAGAGCTGGCAAAGGCCGAGACGCGGGCCAGCATCAGCG
TGACGCTCGTTACAGTGGATACACAGCCGTGTCTGGAGCTGATTCCTCCTGTGGTGATGGTGCCACCGACGGTGCTTCCT
CTGCTCTCAGCGGCGACGCCGGCACCAACGCCGCAGGCCTCGGCCGTGTTCTCGCCCGAGCAGAGCGGCAACCCAGTGAC
ACCAGCAAATCCGGCAACACCAGCAGCTGCAACACCTGCGACACCAGGAGGAGGAGGAGCAGGAGGGGGTGGAGGGCCGA
ACAGCCCGGCAAAAGCAGGGGCTTCGAACGGCAGCGCTGTGAACAAGAGCGCGGACGCAAACCTGGCAGCAGCCGGGGCA
GATCCCAACGCAGTGGCAGAGATCGACGGCAACGTGGCTCTGGTGGACGTGACGGACAACGCGTGGGGAGCGATAGCATC
GCATCGGCTGAACATAGCAGCGACGTGGATCGACCAGCGGCCGGCGCTCGTGAGCGGCTATCTTGTCAAACGGGGTGGAC
TCGGACGCGACGACGCGCCGGTGGTTTTGGAGGTGAACGTGATCCGCACCGAAGGCAGTCCGCGGACGTATGAGCAGCTC
GTGCGAGAGCTCCTGTCGTCGTTCCGGGGTCTGGGCACACTGGCGCGAGCCAGGGGCATTCTCGACGGCGAGCGGGATGT
TCGGCCGTGGCACATTGCCGCAGCCGAGCGAGCGGCAAAGGCGCTTTGCCGGTGGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62