GenePrediction:GLEAN_2960 Details

Name: GLEAN_2960
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:154671..156651 (+ strand)
Length: 1981
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:154671..155069 (+ strand)
Length: 399
Type: CDS
Source: GLEAN
Position: GCSC_124:155124..155364 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_124:155543..155995 (+ strand)
Length: 453
Type: CDS
Source: GLEAN
Position: GCSC_124:156068..156651 (+ strand)
Length: 584
>GLEAN_2960 class=GenePrediction position=GCSC_124:154671..156651 (+ strand)
ATGGCCCATGACCAGGATGCCATCTCCCGGCTACCCAACAAGGACAGCCTTGTTGTTCAAATTATAAACAGTGTGGAGCC
AGGTAGTTTCCACGAAGATGTGCCGGACACTCTTCGTATCTACGAGGCCGATGAAAACAAAGACGGCCATGGCCCTCTAA
GAAGTCCTTCCGTAGAGATACGAGATATTACTGCAGGTGTATTGCAAGACTCCAAGGATAGCTCGAGTATCACGGATTCG
GAAAGCGAGCAGTCCCAGTACAAGTGCGATGCGGAACAGCCATACCATTTATTTTCGTTGAAGCAGAAGTGGTCAGTGGT
CATCATCATTGGCCTTGCCGGCTTATTCTCGGGCTTGTCTTCAAACATATACTTTCCATCGCTGAATCAAATTTCGCAAG
TGAGTACGTCCGCGTCCGTTAACTTGCCCCCGTCGCTAATACAGGAATGACAGGAACTGCACGTTAGCTCCAATTCTGTG
TCCTTGACCATCACGTCCTATCTTGTTGTCCAGGGAATATCGCCCGTCATATGGGGTGCATTCTCCGACGCACTTGGTCG
GCGACCGATCTACATTGCCTCTTTCTCTGTCTACATCGTTGCCAACATTGCGCTGTCATTCTCACCAAGCTTTGCCATCC
TTTTGATTTTCAGAGGCTTGCAGGCCGCTGGCAGCGCTTCTACTGTCAGCATCGGTAAGTCTTTGCATCTGGATATATCT
CGGCTCTACCAGACTAACATAGTCATCAGGGAATGGCGTTATTCAGGACATTTCGCCGCCTGCTGAAAGGGGAGCCTTCA
TCGGTTTTTACCAAGCCAGTAAGCTTTTCTGCTTCGACCGCTCTTCCGTGACATACTGACAACTTTGAACAGTTCGGAAC
TTCAGCATCGCTGTTGGACCTGTTCTAGGTGGTGTTCTCGGAAACTATCTTGGGTTCAGGTCAATCTTCATATTTTTGCT
GATTTTGTCATCACTTGTCCTCGTTACCATTGTCGGCTTCCTTCCGGAAACCATGCGAAGACTAGCAGGTGATGGCCACT
TGCGGCAGAAGGGGATCTATCAACCTCTGATGTACAAATTCGTGAAGGAGCCGAGCTATATTAGCGATCCCGAAGAGGAG
GCTGCCAGTGCAAAGAAGAGTATTTCACTTGCGACCTTTGTTGAACCGTTGAGGCTCCTGACGCAAAAAGAAATCATCCT
CAACTTGATATATGGTGGCGTGATCTATGCCATCTGGAGCATGGTCACATCAAGCACGACAAGCTTGTTCCAGTCGAACT
TCGGCTTGGATGAAACCCTTATTGGCCTCGCATATTTGCCCAATGGTATGATTTTAGCGACTGCATATTGAGCAGTATCC
TTACTCTTCTACGGCATCGTATTAACCTTCTCCTCAGGCTTAGGAACGATTATCGGCTCCGCAATCGTTGGACGGCAGAT
GACGCAAGACTACAAAGCAGCCGAGGCCGCATATATAGTGGAAAAACAACTCCCAGCCGAGTATAAAGTACCAGCAAAAG
ACTTACCTTTAGACTTTCCTGTCGAGAAAGCACGCCAACGCAGCTTGCCGCTGTTCACGGTGTTGTTTGTTATTTCCACC
GGGTTGTATGGATTTTCGGTGTCATCGCACAGACTCTCGGCCAGGCCTGGCTGGATTGCCGTGCCGCTTCTGCTACAGTT
TTTGATCGCTGCCTCTAGCAATGCCGTCTTCGCGATGAACCAGACTCTAATCTCGGATCTGTGTCCCGGCAAAGGTGCAG
GAGGAACGGCTGTGAACAACTTGGTGCGATGCGGTCTGGGTGCTATTGGAGTATCGTTTGTTGAGAGGATGATTGGGGCC
ATGGGCCCTGGCCCGGCATTCCTGACGCTGGCACTGATCACTGTTGCGTGCATACCTCTCGCCGTTGTGACCTGGGTCTG
GGGGATGGAATGGAGAGCAGCCAGAGCACAGCGGAGAGCGAAGCAGATTGAGAAGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62