GenePrediction:GLEAN_2961 Details

Name: GLEAN_2961
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:158184..159301 (+ strand)
Length: 1118
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:158184..158247 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_124:158307..159007 (+ strand)
Length: 701
Type: CDS
Source: GLEAN
Position: GCSC_124:159071..159301 (+ strand)
Length: 231
>GLEAN_2961 class=GenePrediction position=GCSC_124:158184..159301 (+ strand)
ATGCGTCTTGTAGTTCGACCTGACTCTGAGGCTGCCTCGCAGTATGTGGCCGAGTACATCATCAGTGGGTCATCTCTCCG
TCTTTTGGCCGTCTTAGCCCTGCTTCTGCAAGCTGACCTCCAGACCGCATCACGGCTTTTGCGCCGTCAGCCGAACGACC
GTTTGTGCTCGGCCTACCGACCGGCTCCAGTCCGCTGATTGTGTACCGGCTGCTCGTGGCAGCCTTCAAGGCCGGCCAGC
TGTCGTTTCAGCATGTCGTGACCTTTAACATGGACGAGTATGTTGGTCTGCCGCGCGAGCATCCCGAGTCGTACCACAGC
TTCATGTTTGCCAATCTCTTCCGCCACGTCGACATCCCGGCTGCCAACGTGCACATCCTGGACGGCAACCCGGCCGACGG
CGATTTTGCGGCCGAATGCAGCCGCTACGAGGCGCAGATCCGTGCTGCCGGCGGCATCGAGCTCTTCCTCGGCGGTGTTG
GCAGCGACGGCCACATCGCCTTCAACGAGCCCGGATCGTCGCTGGCGTCGCGCACTCGCGTCAAGTCGCTGGCTTTTGAA
ACACAAGTGGCCAATGCGCGCTTCTTTGGCGGTGACGTCTCTGCTGTGCCGCGCATGGCCTTGACGGTCGGTGTCGCCAC
AATTCTCGACGCCCGTGAGGTCGTCATCATCGCCACTGGCCACAGCAAGGCTGCGGCTATCCAACAGGCCGTCGAGGGCG
CCGTCAGCCACATGTGCACGCTCAGCTGCCTACAGATGCATGCCCGCAGCATGGTAGTCGTTGATGATGCCGCCACTGTC
GATTGCAAAGTCAAGACTGTGAATGTGAGTGTGTCGTAGTGGTGTGTTGAGGTATCACAATCTTGGCTGTTGTTCTGACC
CCCGCAGTACTTCAAAGGCGTCGAGGACACGATCCGGCAAAAAAACGTATTCGAGATCCCTCGGCGGAAGAAGCTGCACG
CTCTCGACACCAACGTGCCGCCCCGGAATGTCCCCGACGCCGAGGATGGTGAGCTGACGCCTGACAGCATGTCGTCGCGC
ATCCCCGGGATGAGCCCCAAGATTCTCAGCGTGCGTTCGGCCACCATCACTTTTGCCAGCACTTCTGGTCAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62